ID: 1022009557 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:26297048-26297070 |
| Sequence | TATTTTAATATTTATAATTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2957 | |||
| Summary | {0: 1, 1: 2, 2: 22, 3: 308, 4: 2624} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022009557_1022009559 | 28 | Left | 1022009557 | 7:26297048-26297070 | CCAAAATTATAAATATTAAAATA | 0: 1 1: 2 2: 22 3: 308 4: 2624 |
||
| Right | 1022009559 | 7:26297099-26297121 | AGCTTTTTGTTGTTTTGAGACGG | No data | ||||
| 1022009557_1022009558 | -3 | Left | 1022009557 | 7:26297048-26297070 | CCAAAATTATAAATATTAAAATA | 0: 1 1: 2 2: 22 3: 308 4: 2624 |
||
| Right | 1022009558 | 7:26297068-26297090 | ATATATGTAAATATAGAAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022009557 | Original CRISPR | TATTTTAATATTTATAATTT TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||