ID: 1022009557

View in Genome Browser
Species Human (GRCh38)
Location 7:26297048-26297070
Sequence TATTTTAATATTTATAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2957
Summary {0: 1, 1: 2, 2: 22, 3: 308, 4: 2624}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022009557_1022009559 28 Left 1022009557 7:26297048-26297070 CCAAAATTATAAATATTAAAATA 0: 1
1: 2
2: 22
3: 308
4: 2624
Right 1022009559 7:26297099-26297121 AGCTTTTTGTTGTTTTGAGACGG No data
1022009557_1022009558 -3 Left 1022009557 7:26297048-26297070 CCAAAATTATAAATATTAAAATA 0: 1
1: 2
2: 22
3: 308
4: 2624
Right 1022009558 7:26297068-26297090 ATATATGTAAATATAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022009557 Original CRISPR TATTTTAATATTTATAATTT TGG (reversed) Intronic
Too many off-targets to display for this crispr