ID: 1022009558

View in Genome Browser
Species Human (GRCh38)
Location 7:26297068-26297090
Sequence ATATATGTAAATATAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022009557_1022009558 -3 Left 1022009557 7:26297048-26297070 CCAAAATTATAAATATTAAAATA 0: 1
1: 2
2: 22
3: 308
4: 2624
Right 1022009558 7:26297068-26297090 ATATATGTAAATATAGAAGATGG No data
1022009556_1022009558 21 Left 1022009556 7:26297024-26297046 CCATTTAAAGATTAAATGTCAAA 0: 1
1: 1
2: 3
3: 68
4: 626
Right 1022009558 7:26297068-26297090 ATATATGTAAATATAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022009558 Original CRISPR ATATATGTAAATATAGAAGA TGG Intronic
No off target data available for this crispr