ID: 1022010074

View in Genome Browser
Species Human (GRCh38)
Location 7:26301146-26301168
Sequence GTTTTTGGGGGGATTTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 440}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022010074_1022010086 23 Left 1022010074 7:26301146-26301168 CCTTCCCAAATCCCCCCAAAAAC 0: 1
1: 0
2: 5
3: 41
4: 440
Right 1022010086 7:26301192-26301214 CAGGCTTTCTGGCATTAACAAGG 0: 1
1: 0
2: 0
3: 18
4: 185
1022010074_1022010084 12 Left 1022010074 7:26301146-26301168 CCTTCCCAAATCCCCCCAAAAAC 0: 1
1: 0
2: 5
3: 41
4: 440
Right 1022010084 7:26301181-26301203 GTATGTCTAACCAGGCTTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 94
1022010074_1022010083 4 Left 1022010074 7:26301146-26301168 CCTTCCCAAATCCCCCCAAAAAC 0: 1
1: 0
2: 5
3: 41
4: 440
Right 1022010083 7:26301173-26301195 CACAGAGTGTATGTCTAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022010074 Original CRISPR GTTTTTGGGGGGATTTGGGA AGG (reversed) Intronic
901755071 1:11436582-11436604 GTGTGTGGTGGGGTTTGGGAAGG + Intergenic
902120578 1:14161771-14161793 GATTTTGGGGGGTTTGGAGATGG - Intergenic
902681790 1:18048883-18048905 GTTTATGAGGGCTTTTGGGAAGG - Intergenic
902905884 1:19557195-19557217 TTTTTTTGGGGGGTTTGGGGTGG + Intergenic
903246049 1:22016330-22016352 TTTTTTGCGGGGGTTGGGGACGG + Intergenic
903792634 1:25905708-25905730 GTTTTTGGCGGGAGTTGGGGGGG - Intronic
904045538 1:27606123-27606145 GTTTTAGGAGGGAGTTGGGTGGG + Intergenic
905882424 1:41473368-41473390 GCTTTTGGGCAGATGTGGGAGGG + Intergenic
907054247 1:51350381-51350403 GTTTTTTGGGGTTTTTGAGACGG + Intergenic
908179854 1:61592978-61593000 CTTTTTTGGGGGAATGGGGACGG - Intergenic
908189536 1:61687892-61687914 GTTATTTGGGGGAGTTGGGATGG - Intronic
908760288 1:67505431-67505453 TTTTTTGGGGGGAGCGGGGATGG - Intergenic
909751464 1:79166248-79166270 GACTTTGGGGGCCTTTGGGAAGG + Intergenic
910651690 1:89575067-89575089 GTTTTTGGGGGGCTTGGGAAAGG + Intronic
912297436 1:108484190-108484212 GTTTTTGTGTGGTTTTGGGAGGG - Intergenic
912392997 1:109317727-109317749 ATTTTTGGCGGGGTTGGGGAGGG - Intronic
912600988 1:110933469-110933491 GCTGTTGGGGGGTTTGGGGAGGG - Intergenic
913013584 1:114710188-114710210 TTTTTTGGGGGGGGTTGGGGGGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914909833 1:151776003-151776025 GTTGTCAGGGGGATTTGGAAGGG - Intronic
915012282 1:152698937-152698959 ATTTTGGGGGGCACTTGGGAGGG - Exonic
915472407 1:156133883-156133905 ACTTTTGGGGGGCTCTGGGAAGG - Intronic
915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG + Intronic
917370323 1:174286125-174286147 TTTTTTGGAGGAATTTGTGAAGG + Intronic
917721591 1:177791337-177791359 TTTTTTGGGGGGAGTGGGGACGG + Intergenic
918017481 1:180650151-180650173 ATTTTAGTGGGGTTTTGGGAAGG + Intronic
918141174 1:181721233-181721255 AGTTTTGGGGGGAGTAGGGATGG - Intronic
918169460 1:181982663-181982685 GTCTTTGGAGGGTTTTGGAAGGG - Intergenic
918549028 1:185718670-185718692 CTTTTGTGGGGGATGTGGGATGG + Intergenic
919142676 1:193592056-193592078 TTTTTGGGAGTGATTTGGGAGGG + Intergenic
919844968 1:201636285-201636307 GGGTTTGGGGGGTCTTGGGATGG - Intronic
920407186 1:205724687-205724709 TTTTTTGGGGGGGGTGGGGATGG - Intronic
920552577 1:206875834-206875856 GTTTTTTGGGGGAGGGGGGAGGG - Intergenic
922078619 1:222272474-222272496 GATTTTGGGGGCTGTTGGGATGG - Intergenic
922219597 1:223548375-223548397 GTTTTTGGGAGGAATGGAGAAGG - Intronic
923094984 1:230767863-230767885 AGTTTTGGGGGGAGGTGGGAGGG + Intronic
923297314 1:232607505-232607527 AATTTTATGGGGATTTGGGATGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924539290 1:244966099-244966121 ATTTTTGGGGGGAGAGGGGAGGG + Intergenic
924747135 1:246846747-246846769 TTTTTTGGGGGGATGGGGGTGGG + Intronic
1062892279 10:1072729-1072751 TATTTTGGGGGAATTTGGGAGGG - Intronic
1063804580 10:9623703-9623725 GTTTTTGGGTGTGTTTGTGAGGG - Intergenic
1065487236 10:26247320-26247342 GGTTTTGGTGGGTTTTGGCAAGG + Intronic
1065673465 10:28147917-28147939 GTTTTTGTGGGGGTTGGGGGAGG - Intronic
1067682963 10:48451752-48451774 GTGTGTTGGGGGATTTGGGGAGG - Intronic
1067682990 10:48451900-48451922 CTGTATGGGGGGATTTGGGGAGG - Intronic
1067683011 10:48451996-48452018 GTGTATGGGGGAATTTGGGGAGG - Intronic
1068221952 10:54056716-54056738 GATTTTGGGTGGCTTTTGGAAGG - Intronic
1068595025 10:58893742-58893764 TTATTTGGGGGGATTTGTTATGG - Intergenic
1069817260 10:71206290-71206312 GTTTCTGGGGGTATCTGTGAGGG + Intergenic
1070535226 10:77372206-77372228 GGGTTTGGGTGGATTTGAGAGGG - Intronic
1070840872 10:79487079-79487101 GTGTTTGGGGGGACTGTGGAGGG + Intergenic
1071446083 10:85748828-85748850 GTGTTTGAGGAGTTTTGGGATGG - Intronic
1071492135 10:86143378-86143400 TTTTTTGGGGGGATGGGGTAGGG - Intronic
1071553064 10:86582160-86582182 GTTTTTTGGGGGGTGGGGGATGG + Intergenic
1073617152 10:105007647-105007669 TTTTTTGGGGGGTTGGGGGAGGG - Intronic
1073974565 10:109086118-109086140 GTTTTTGGGGGGAGGTGAAAGGG + Intergenic
1074076410 10:110129848-110129870 ATTTTAGTGGGGTTTTGGGAGGG + Intronic
1074296608 10:112195139-112195161 GTGTATGGGGGTATTTGGCATGG - Intronic
1075625283 10:123959795-123959817 CTTTTTGGTGGGATTTGGGGTGG + Intergenic
1075990569 10:126835271-126835293 GTATTTGGGGCCATTTTGGAAGG + Intergenic
1077344446 11:2039787-2039809 GTGTTTGGGGGGGTTTTGGGGGG + Intergenic
1078098085 11:8312688-8312710 GTTTTTGGTGGGAGGTGGCAGGG + Intergenic
1078375063 11:10786454-10786476 GTTTTTGGAGGCATGAGGGAGGG + Intergenic
1078880556 11:15444805-15444827 GGTTTTGTGGGGAATGGGGAGGG - Intergenic
1082296652 11:50448024-50448046 GTTTTTGGTAGGATCTGTGAAGG + Intergenic
1084004314 11:66315092-66315114 GGATTTGGGGGGCTTTGGAATGG + Exonic
1084142351 11:67240958-67240980 ATTTTTGTGGGGAATAGGGAAGG - Intronic
1084271535 11:68031815-68031837 GTTTTTGGTTAGATTTGGGGAGG + Intronic
1085745163 11:79108919-79108941 GTTTGTGTGGGGAATGGGGAAGG - Intronic
1087277816 11:96177860-96177882 GTTTTTGAGGGAATTTTTGAGGG + Intronic
1088100854 11:106154349-106154371 GTTTTTGTGTGAGTTTGGGAGGG + Intergenic
1088626367 11:111733209-111733231 GTTTCTGGGGGGATTTCCTAGGG + Intronic
1089149288 11:116352357-116352379 GTTTTAAGGGGGATTTAGGAAGG + Intergenic
1089988939 11:122839695-122839717 ATTTTTGAGTGGATTTGTGAGGG - Intronic
1090828210 11:130402671-130402693 GTTTTTTGGGGGGTGTGGGGAGG + Intergenic
1090828211 11:130402672-130402694 TTTTTTGGGGGGTGTGGGGAGGG + Intergenic
1090860959 11:130651903-130651925 GTTTTTGCTGGGTTTTGGGGAGG + Intergenic
1202827432 11_KI270721v1_random:94976-94998 GTGTTTGGGGGGGTTTTGGGGGG + Intergenic
1091629358 12:2147771-2147793 TGTTTTGGGGGGATTTTGGGGGG + Intronic
1091629359 12:2147772-2147794 GTTTTGGGGGGATTTTGGGGGGG + Intronic
1093174947 12:15902430-15902452 GATTTTGGGGGAGGTTGGGAAGG + Intronic
1093260016 12:16924412-16924434 GTTTTTGGGGGATTGTGGGGGGG - Intergenic
1093352329 12:18118771-18118793 GCTTTTAGTGGGATTAGGGATGG + Intronic
1093446677 12:19267657-19267679 TTTTTTGGGGGGTTGGGGGAGGG - Intronic
1096782468 12:53999141-53999163 CTTTTTGGGGGGAGTGGGGGTGG + Intronic
1096984328 12:55745976-55745998 GTGTTTGGGGGGGTTAGGGTGGG + Intronic
1097808432 12:63990953-63990975 GTTTTTTAATGGATTTGGGAAGG - Intronic
1098915199 12:76250072-76250094 GGTTTTAGGGGGATGGGGGAGGG + Intergenic
1099282770 12:80673431-80673453 CTTTTGGGGAGGATTCGGGAGGG + Intronic
1100060166 12:90565773-90565795 GTCTTTGGGGGGCTATTGGAAGG - Intergenic
1101527673 12:105546378-105546400 GATTTTGAGGGGTTTTGGGCAGG + Intergenic
1102514306 12:113436129-113436151 GCTTTTGGGGGGTTTGGGGGAGG - Intronic
1102645646 12:114401974-114401996 GTTTTGGGGGAGTTTGGGGAAGG - Intronic
1103902528 12:124310758-124310780 GCTGTGGGGTGGATTTGGGAGGG + Intronic
1105299560 13:19119534-19119556 GTTTTTGGGTAGATTAGAGAAGG + Intergenic
1105576405 13:21657145-21657167 GTGTGTGGGGGGTGTTGGGAGGG + Intergenic
1105962012 13:25350686-25350708 TTTTTTGGGGGGGGTCGGGAGGG - Intergenic
1106561621 13:30851630-30851652 TTTTTTGGGGGGAAGGGGGAGGG - Intergenic
1107232076 13:38121916-38121938 TTTTTTGGGGGGAATCTGGATGG - Intergenic
1107459713 13:40590069-40590091 GTTATTGGGAGGAGTTGGGTAGG - Intronic
1107628167 13:42312577-42312599 GATGTTGGGGGGAGATGGGATGG - Intronic
1108094604 13:46887910-46887932 GTTGGTGGGGGGAGGTGGGAGGG + Intronic
1108097963 13:46924400-46924422 GTTTTTTGGGGGAGGTGGGTGGG - Intergenic
1108227446 13:48303916-48303938 GTTTTTCGGGGGGTTTTGGGCGG - Exonic
1108971306 13:56380570-56380592 GGCTTTGGGGGACTTTGGGAAGG - Intergenic
1109775239 13:67032147-67032169 TTTTTTGGGGGGGTGAGGGAAGG + Intronic
1110038514 13:70718837-70718859 GATTTTGGGGGACTTTGGGAAGG + Intergenic
1110800644 13:79690133-79690155 TTTTTGGGGGGGATTTGTCAGGG + Intergenic
1111128847 13:83948259-83948281 AGTTTTGGGTGCATTTGGGAAGG - Intergenic
1112128722 13:96498072-96498094 GATTTTGGGGGGATTTCAGTGGG + Intronic
1112560165 13:100505855-100505877 TTTTTGGGGGGGATGGGGGAGGG - Intronic
1112616457 13:101011800-101011822 GGGTTTGGGGGGATTTCGGGGGG - Intergenic
1112776340 13:102847419-102847441 GATTGCGGGGGGATTGGGGACGG + Intronic
1114096713 14:19343664-19343686 TTTTTTGGGGGGGTGGGGGATGG - Intergenic
1116083539 14:40205399-40205421 ATTTTTGTGGAGATTTGGAAAGG + Intergenic
1116441531 14:44960707-44960729 GTTTTTGGGGGGGTGGGGGTGGG - Intronic
1117071327 14:52059440-52059462 GTTTTTTGGGGGGTGTGTGAGGG - Intronic
1117284177 14:54270414-54270436 TTTTTTGGGGTGATTAGGGATGG + Intergenic
1118338591 14:64876561-64876583 ATTTTTGGGGGGCATGGGGAAGG - Intronic
1118907011 14:70030537-70030559 GGTTTTGGGGGGGTGGGGGAGGG + Exonic
1120463207 14:84823520-84823542 ATTTTTTGGAGTATTTGGGAAGG + Intergenic
1121515467 14:94546939-94546961 TTTTTTGGTGGGATCTGGTAAGG - Intergenic
1122138838 14:99650222-99650244 GTTTGGGGGAGGATTGGGGATGG - Intronic
1202843926 14_GL000009v2_random:149339-149361 GTTTATGGCCGGATTTGGGGAGG + Intergenic
1202913317 14_GL000194v1_random:139582-139604 GTTTATGGCCGGATTTGGGGAGG + Intergenic
1124072992 15:26413142-26413164 GTTTGTGGAAGGATTTGGGAGGG - Intergenic
1124711674 15:32017822-32017844 GTTTTTGGGGGAGCTTTGGAAGG - Intergenic
1124917424 15:33989788-33989810 ATTTTAGGTGGGTTTTGGGAAGG - Intronic
1125063645 15:35456044-35456066 TATTTTGGGGTGATTTGGGCAGG - Intronic
1125756803 15:42070319-42070341 GGTTTTGGGGGGCTGGGGGATGG - Intronic
1127851448 15:62915636-62915658 GTTTTTGGAAGAGTTTGGGAAGG - Intergenic
1128456906 15:67836187-67836209 CACTTTGGGGGGAGTTGGGAAGG - Intergenic
1129099681 15:73248568-73248590 GCTTTGGGAGGGGTTTGGGAGGG - Intronic
1129675381 15:77630428-77630450 GTTTTTTGGGGGGTTGGGGTGGG + Intronic
1130761413 15:86824190-86824212 GTTTTTGGGGGGTATTGGGTAGG - Intronic
1130887094 15:88102716-88102738 CTTCTTGGGGAGATTTCGGAGGG - Intronic
1131455187 15:92578249-92578271 TTTTTTGGGTGGAGTTGGGTGGG - Intergenic
1131618035 15:94036928-94036950 ATTTATGAGGGAATTTGGGAGGG - Intergenic
1133653534 16:7835977-7835999 GTTTTTAGGAAGATTTTGGAGGG + Intergenic
1134324443 16:13194086-13194108 GTTCTTGGGGGGATGTGAGAAGG - Intronic
1134914544 16:18058960-18058982 GTGTTTGAGGGTATGTGGGAGGG + Intergenic
1135551669 16:23403246-23403268 GTTTTTGAGGGGGCTTTGGAGGG - Intronic
1135636805 16:24084645-24084667 ATTTCTGGGGGCATTTTGGAGGG - Intronic
1135676331 16:24418015-24418037 TTTTTTGGGGGGTTGGGGGATGG - Intergenic
1136556244 16:31009591-31009613 GGTTTTGGGGGGACAGGGGAAGG - Intronic
1137428747 16:48401324-48401346 GTTTTTGGCGGGGGTTGGGGGGG + Intronic
1137795863 16:51218843-51218865 ATTTTTGGGAGAATTTGAGAAGG - Intergenic
1138166434 16:54806066-54806088 GTTTTTGGGTGTGTTTGTGAGGG - Intergenic
1138316688 16:56076339-56076361 GTGTTAGCGGGGTTTTGGGAAGG + Intergenic
1138876068 16:60951551-60951573 CTATTTGGGGGAATTTCGGAGGG - Intergenic
1139470698 16:67176692-67176714 GTTTCTTGGGGGTGTTGGGAGGG - Exonic
1139835994 16:69838990-69839012 TTTTTTGGGGGGGTGGGGGAAGG + Intronic
1140220801 16:73042559-73042581 GTACTTGGGGTGATTTGGGGTGG - Intronic
1140874036 16:79133892-79133914 TTTTTTGGGGGCATTTGTCAGGG + Intronic
1140970133 16:80004630-80004652 GTTTTGGGGGTGATTTGTTATGG + Intergenic
1142860293 17:2756630-2756652 GTGTGTGGGATGATTTGGGATGG - Intergenic
1142986547 17:3698473-3698495 TTTTCTGGGGTGATTAGGGAAGG + Intergenic
1143141366 17:4743611-4743633 GTTTCTGGGTGGAGTTGGTAGGG - Intronic
1143483587 17:7240479-7240501 TTTTTTGGGGGTAGTTGGAAGGG - Exonic
1143523625 17:7460553-7460575 TTTTTTGGGGGGAGGTGGGTGGG + Exonic
1144526363 17:15993913-15993935 GTTTTAGTGGGGTTTGGGGAAGG - Intronic
1144555145 17:16275368-16275390 GGTTTTGGTGGGATTTTGGTGGG + Intronic
1150292121 17:63988108-63988130 GATTTTAGGGGGCTTGGGGAAGG - Intergenic
1151756545 17:76078471-76078493 GTTGTTGGGGGGAAGTGGGGTGG + Intronic
1152362118 17:79837588-79837610 GTTTTGGGGGAAGTTTGGGAAGG - Intronic
1152505416 17:80746524-80746546 GTCTTCTGGAGGATTTGGGAAGG - Intronic
1152589179 17:81203047-81203069 GGTCTTGCGGGGATTGGGGATGG - Intronic
1153993078 18:10417241-10417263 ATTTTTTGGGGCCTTTGGGATGG - Intergenic
1154028304 18:10727037-10727059 TTTCTTGGGGGGTGTTGGGAGGG + Intronic
1155290307 18:24333994-24334016 GTTTTCAGGGGGATTAGGGTGGG + Intronic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1156394502 18:36686484-36686506 GTCAGTGGGGGGATTGGGGAGGG + Intronic
1156396370 18:36703661-36703683 GTTGGTGTTGGGATTTGGGAGGG + Intronic
1156747927 18:40415093-40415115 TTTTTTCGGGGGACTAGGGAGGG + Intergenic
1157038210 18:44003381-44003403 TTTTTTGGAGGAATTTGAGAAGG - Intergenic
1157416890 18:47510857-47510879 GTGTTTTGGGGGATTGGAGAGGG + Intergenic
1158189657 18:54812150-54812172 CATTTTGGGGGGTTTTGGGATGG + Intronic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159068434 18:63594831-63594853 TTTTTTGGGGGGGTGGGGGATGG - Intronic
1159795898 18:72843051-72843073 TTTTATGGGGAAATTTGGGAGGG + Intronic
1160747839 19:720152-720174 GTGCTTGGGGGGATTGGGGGGGG - Intronic
1161870488 19:6865925-6865947 GGTTTTGGTGGGATTTGGGCTGG + Intergenic
1162807612 19:13146347-13146369 ATTTTTGGGGGGATTTTAGCTGG + Intronic
1162821654 19:13226822-13226844 TGTCTTGGGGGGATTAGGGACGG + Intronic
1163883916 19:19949622-19949644 GCCTTTGTGGGGTTTTGGGAGGG - Intergenic
1163997686 19:21067542-21067564 TTTTTTGGGGGGAGTGGGGTGGG - Intergenic
1164680320 19:30130276-30130298 GTTGTTGGGGGGACCTGTGACGG + Intergenic
1164919504 19:32078285-32078307 TATTTTGGGGGGATGGGGGAGGG - Intergenic
1166043381 19:40216025-40216047 GTTCTTGGGGGGACCAGGGAGGG - Intergenic
1167316474 19:48766234-48766256 TTTTTTGGGGGGGTGGGGGAGGG + Intergenic
1167389587 19:49185753-49185775 TTTTTTGGGGGGAGGGGGGATGG + Intronic
1168249122 19:55131462-55131484 GTTTTTGAGGGGCTAGGGGACGG - Intergenic
1168347952 19:55660014-55660036 GTGTTTGGGGGGAAATGGCAGGG + Intronic
1202654950 1_KI270708v1_random:12115-12137 GTTTATGGCCGGATTTGGGGGGG - Intergenic
925021448 2:572641-572663 GTGGTTGGGGGAATGTGGGATGG + Intergenic
925138246 2:1534257-1534279 CATATTGGGGGGATTTGAGAAGG - Intronic
925138688 2:1536093-1536115 CATAATGGGGGGATTTGGGAAGG - Intronic
925940091 2:8808898-8808920 TTTTTTAGGGGGGTTTGGTAAGG - Intronic
926029712 2:9575555-9575577 TTTTTTGGGGGGGGTTGGGGAGG - Intergenic
927528634 2:23772727-23772749 TTTTTTGGGGGGATGGGGGTGGG + Intronic
929088088 2:38188503-38188525 GTTTTTGAGGGTATTTGGAAAGG - Intergenic
930114837 2:47709612-47709634 CTTTTTGGGGGGAGTTGGGGTGG - Intronic
933865657 2:86514887-86514909 CTTTTTTGGGGGATGTGGGGAGG - Intronic
935186751 2:100741497-100741519 TTTTTTGGGGGGATAGGGGTGGG - Intergenic
937179417 2:119976913-119976935 TTTTTTGGGGGGAGAGGGGACGG + Intronic
938454484 2:131450022-131450044 CTTTTTGGGGGGGATTGGGTGGG + Intergenic
939550485 2:143609538-143609560 CTTTTTGGGTGGGTATGGGAGGG - Intronic
941092819 2:161197966-161197988 TCTTTTGGGGGCTTTTGGGATGG - Intronic
941094769 2:161225925-161225947 GTTTTTGGGGAGGTGGGGGAAGG - Intronic
942132681 2:172896570-172896592 TTTTTTGGGGGGGGGTGGGATGG - Intronic
942271024 2:174275427-174275449 TTTTGTGGGGGGAGTGGGGAGGG - Intergenic
944402599 2:199345413-199345435 GTTTGTGGGGGGAGGGGGGAGGG - Intronic
944693873 2:202183445-202183467 TTTTTTGGGGGGTTTTTGGGGGG + Intronic
944821994 2:203440849-203440871 GTTTTGGGGGAGCTTGGGGAGGG + Exonic
945349071 2:208755208-208755230 GTTCTTCGTGGGATTTGGCAGGG - Intronic
945585273 2:211653673-211653695 TTTTTTGGGGGGGTTTGAGGGGG + Intronic
945815108 2:214595978-214596000 GTATTTGGGGGGAGGGGGGAGGG + Intergenic
946357804 2:219199496-219199518 TATTTTGGTGGGGTTTGGGAAGG + Intronic
946807816 2:223489337-223489359 ATGTTGGGTGGGATTTGGGAGGG - Intergenic
946930641 2:224667054-224667076 GTTTTTGAGTGTATCTGGGAGGG - Intergenic
947224583 2:227827502-227827524 GCTTTTGGGATGATTTGGAATGG + Intergenic
947584483 2:231345214-231345236 ATTTTTGGGGGATTTTTGGAGGG + Intronic
947702932 2:232250302-232250324 GTTTTAGTGAGGTTTTGGGAGGG - Intronic
948795179 2:240398990-240399012 GCTTTTGGGGGGACCTGGGGAGG - Intergenic
1169074195 20:2751550-2751572 GTTTTCCGGGGGACTTGGGCTGG + Intronic
1171341177 20:24430998-24431020 GCTGTTGGGGGAATTTGGGCTGG - Intergenic
1171882284 20:30627421-30627443 GTTTTTGGAGGATTTTGGGGGGG + Intergenic
1172160764 20:32866525-32866547 GCTTCTGGGGGGATTTGGGAAGG + Intronic
1173383166 20:42564581-42564603 GTTGTTGGGGGGACAAGGGAAGG + Intronic
1174026457 20:47580557-47580579 TTTTTTGGGGGGATGGGGGTGGG - Intronic
1174059238 20:47820953-47820975 GTTTTTGGGGGAGTTAGTGATGG + Intergenic
1174146449 20:48455677-48455699 CTGTTTTGGGGGATTTGGGCGGG + Intergenic
1174680224 20:52399399-52399421 ATTTGAGAGGGGATTTGGGAAGG + Intergenic
1174883768 20:54308999-54309021 GTTTCTGGGGGAATTTGGAATGG + Intergenic
1174951737 20:55049796-55049818 GTTTTTGTGTGGTTTTGGTATGG - Intergenic
1175548981 20:59803874-59803896 GTGTTTGGGGGCATTTGGGGAGG + Intronic
1175756331 20:61532737-61532759 GTTCTAGGGGAGATTGGGGAAGG + Intronic
1176632680 21:9154259-9154281 GTTTATGGCCGGATTTGGGGAGG + Intergenic
1177790923 21:25721427-25721449 GTGTATGGATGGATTTGGGATGG + Intronic
1177831818 21:26147854-26147876 TTTTTTGGGGGGGTTGGGGAGGG - Intronic
1178111013 21:29370263-29370285 GTTCCTGGTGGGATTTGGGTGGG + Intronic
1178297968 21:31426882-31426904 GTTTTTGAGGGGCTTGGGGTGGG + Intronic
1179889541 21:44328640-44328662 ATTTTTGGGGTGACTTGGGGAGG + Intergenic
1179907067 21:44427893-44427915 GGTGTTGGGGGTATGTGGGACGG + Intronic
1180349657 22:11789953-11789975 GTTTATGGCCGGATTTGGGGGGG - Intergenic
1180373945 22:12073399-12073421 GTTTATGGCCGGATTTGGGGAGG - Intergenic
1180484030 22:15778930-15778952 TTTTTTGGGGGGGTGGGGGATGG + Intergenic
1180673805 22:17573363-17573385 GGTTTTGGGGGGAAGTGGGGAGG - Intronic
1181546095 22:23603492-23603514 GTCTCTGGAGGGATTTGGGTAGG - Intergenic
1181754447 22:25013370-25013392 TTTTTGGGGGGTGTTTGGGAAGG + Intronic
1181823411 22:25493741-25493763 GTTTGTCGGGGGAGTGGGGAGGG + Intergenic
1182063126 22:27412043-27412065 GTTTTTGGGGAGTTGTGGGCAGG - Intergenic
949150901 3:765894-765916 GATTTTGGGGGATGTTGGGATGG + Intergenic
949981288 3:9503262-9503284 GTTGTTAGGGGGCTTTGGGAAGG + Intronic
950271212 3:11616592-11616614 GTTTTTGGGGTGATGTGGCAGGG - Intronic
951005172 3:17607653-17607675 GTTTTTGGGGGGTATTGGCGGGG - Intronic
951591673 3:24272412-24272434 TTTTCTGGGGGGCTTTGAGAGGG - Intronic
952381031 3:32805579-32805601 TTTTTTGGGGGGGTGGGGGATGG + Intergenic
952467262 3:33602649-33602671 GTTTCTAAGGGGGTTTGGGAAGG - Intronic
952671447 3:35974193-35974215 GATTTTGGGGGACTGTGGGAAGG - Intergenic
952861274 3:37814557-37814579 TTTTTTGGGGGGGTGGGGGATGG - Intronic
952920355 3:38279600-38279622 CTTTTTGGGGGGATTATGGTTGG + Intergenic
953851648 3:46469663-46469685 GATCTTGGGGGGACTTGGGTGGG - Intronic
954224182 3:49172006-49172028 GCTTCTGGGGGGGTTTGGAATGG + Intronic
955300854 3:57777099-57777121 TTTTTTGGGGGGAGGGGGGAGGG + Intronic
955334302 3:58072232-58072254 GTTATTGGCTGGATTTGGGGAGG + Intronic
955909217 3:63843080-63843102 GTTTTTGGAGGGGTTGGGGCAGG - Intronic
956352130 3:68349195-68349217 GGTTTTGGGGGGGTTTGGCTTGG + Intronic
956421478 3:69090751-69090773 AATTCTGGGAGGATTTGGGAAGG - Intronic
957099538 3:75810103-75810125 GTTTATGGCCGGATTTGGGGGGG + Intergenic
957766277 3:84629173-84629195 TTTTTTGGGGGGGTGGGGGATGG + Intergenic
957817237 3:85317128-85317150 TTTTTTGGGGGGATGGGGGGTGG + Intronic
958600703 3:96293266-96293288 GTTTTTAATGGGATTTGTGAAGG + Intergenic
958736114 3:98011098-98011120 TTTTTTGGGGGGGTTGGGGGAGG - Intronic
959578911 3:107964329-107964351 GTTTATGGGGTGAACTGGGATGG - Intergenic
960985288 3:123275459-123275481 GGATTTGGGGGGATTTGTGTAGG + Intergenic
961236273 3:125370996-125371018 TTTTTTGGGGGGATGTAGTAGGG - Intronic
961769727 3:129240222-129240244 GTTTATGGAGCAATTTGGGAAGG - Intergenic
962805221 3:138922313-138922335 GTGTCTGAGGGGACTTGGGAAGG - Intergenic
962907074 3:139813591-139813613 GGTTTTGGTGGGATTTGGCTGGG + Intergenic
963864182 3:150342652-150342674 GGTTTTGGGGTAATTTGTGATGG - Intergenic
963956916 3:151264183-151264205 GATTTTAGGGGAATGTGGGAGGG - Intronic
965079513 3:164019539-164019561 GTCTTTGAGGGGAACTGGGAAGG + Intergenic
965226370 3:165997789-165997811 CTCTTTGGGGGACTTTGGGAAGG - Intergenic
965433930 3:168623298-168623320 GTTTTCTGTGGGATTTGGGGAGG + Intergenic
966556429 3:181266326-181266348 ATTTTAGTGGAGATTTGGGAGGG + Intergenic
966587111 3:181638503-181638525 GATTTGGGTGGGGTTTGGGAAGG + Intergenic
967602595 3:191407018-191407040 TTTTTTGGAGGAGTTTGGGAAGG + Intergenic
967647762 3:191947284-191947306 TTTTTTGGGGGGGCTGGGGATGG + Intergenic
968634640 4:1671690-1671712 GTGGTTGGTGGGATTAGGGAGGG - Intronic
969338428 4:6525704-6525726 CTTTTTGGGGGGATGGGGGAGGG + Intronic
971212150 4:24629197-24629219 AGGTTTGGTGGGATTTGGGACGG - Intergenic
971403515 4:26298747-26298769 GTTGTTGGGGGGATGTGGAAAGG + Intronic
971631579 4:28999381-28999403 GTTAAAGAGGGGATTTGGGAGGG - Intergenic
972358118 4:38301622-38301644 TTTTTTGGGAGGATTTGAGAAGG - Intergenic
973265724 4:48208411-48208433 GATTTTGGAGGGTTTTGAGATGG - Intronic
973365950 4:49209868-49209890 GTTTTTGGAGGATTTTGGGGAGG + Intergenic
974236060 4:59182779-59182801 GTTTTTTGGGGGATAGGGTATGG + Intergenic
974304099 4:60108831-60108853 GGTTTTGGTGGGATTTAGAAGGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974753351 4:66170722-66170744 GTTTATGGCAGGATTTGGGGGGG + Intergenic
974793810 4:66722587-66722609 CTTTTTTGGGGGAGTGGGGACGG - Intergenic
975359747 4:73454770-73454792 GTTTTTGGTGGGATCAGGTAGGG + Intronic
975505927 4:75137566-75137588 GTTTTAGGGGGGTTGTGGAAAGG - Intergenic
975749215 4:77505778-77505800 ATTTTTGTGGGGAATGGGGATGG + Intergenic
976661347 4:87543624-87543646 AATTTTGGGGGCATGTGGGAAGG - Intergenic
976680677 4:87752887-87752909 GATTTTGGGGGACTTTTGGAAGG - Intergenic
976806774 4:89056760-89056782 GTATTAGGCAGGATTTGGGATGG - Intronic
976826703 4:89268530-89268552 AGTTGTGGGGGGATTTGGGAGGG - Intronic
977861348 4:101964364-101964386 GTTTCTGTGGGGCTGTGGGATGG - Intronic
978334251 4:107648774-107648796 GTTTTTGTGGGTTTTTGTGAAGG + Intronic
978490713 4:109308739-109308761 GTTTTTGGGGGGGTTTTGGGGGG + Intergenic
979314778 4:119249272-119249294 GATTTTGGTGGGATTTTGGTGGG + Intronic
979411722 4:120387172-120387194 GTTATTGGTGTGATTTGGGGTGG - Intergenic
980212270 4:129804827-129804849 ATTTTAGGTGGGACTTGGGAAGG - Intergenic
981550967 4:145940398-145940420 TCTTTTGGGGGGAGTTGGCAGGG - Intergenic
981721509 4:147806487-147806509 GTTTTTGGGGGGGCGGGGGATGG + Intronic
982689941 4:158537315-158537337 TTTTTTGGGGGGACAAGGGAAGG - Intronic
983698658 4:170564676-170564698 TTTATAGGTGGGATTTGGGAGGG + Intergenic
983972620 4:173893242-173893264 GTTTATGGTGAGATTTGGGGGGG + Intergenic
984291658 4:177803157-177803179 GATTTTGGGGGGCTTGGGAAAGG - Intronic
984363399 4:178767528-178767550 GTTTATGGTTGGATTTGGGGGGG - Intergenic
1202755530 4_GL000008v2_random:58838-58860 GTTTATGGCCGGATTTGGGGAGG - Intergenic
986174609 5:5341305-5341327 GGCTTTGGGGCGATTTAGGATGG - Intergenic
986551650 5:8962753-8962775 GGGTTTGGGGGGATAGGGGAGGG - Intergenic
989389869 5:40888885-40888907 GTCTTTGGGGGGCACTGGGATGG - Intergenic
989471067 5:41819363-41819385 TTTTTTGGGGGGGATTGGGGGGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
991078639 5:62570299-62570321 TTTTTTGGGGGGAGTGGAGAGGG - Intronic
994405276 5:99338171-99338193 GGCTTTTGGGGGATTGGGGAGGG - Intergenic
994457750 5:100034206-100034228 GTTGTAGGGGGAATTAGGGATGG + Intergenic
994784422 5:104138174-104138196 GTTTTTGGGGGGGTGAGGGAAGG - Intergenic
995227423 5:109717069-109717091 TTTTTTGTGGGGATTGGAGAGGG + Intronic
995640000 5:114244609-114244631 GTTATTGGGGGGAGTGTGGAGGG + Intergenic
995904394 5:117105975-117105997 ATTTTTGGGGGGTTTGGGGTGGG + Intergenic
996684978 5:126269957-126269979 GTTTGGGGAGGGATCTGGGAAGG + Intergenic
996727920 5:126688729-126688751 GTTTTTGGTGGGTTTTTGGTGGG - Intergenic
996802732 5:127421452-127421474 GTTCTTGGGTGGTGTTGGGAAGG + Intronic
996990329 5:129622771-129622793 GTATTTGGGAGGATGTGGGTAGG - Intronic
997882018 5:137600023-137600045 ATTTTTGGTGGGAATTGGGAAGG + Intergenic
999678176 5:154028003-154028025 TTTTTTGGGGGGATCAGGGATGG - Intronic
999735108 5:154507020-154507042 GTTGTTAGGGTGAGTTGGGAAGG - Intergenic
1000046997 5:157530257-157530279 GGTTCTGGGGTGATTAGGGAAGG - Intronic
1000153552 5:158527854-158527876 GTGTCTGGGGGGATTGTGGAAGG + Intergenic
1000181338 5:158814416-158814438 GTTGTAGGGGAGATTTGGGGAGG - Intronic
1002042745 5:176526657-176526679 CTTTTTGGTGGGAGGTGGGATGG - Intergenic
1003030948 6:2600155-2600177 TATTTTGGGGGGAGTTGGGGTGG - Intergenic
1003141267 6:3473386-3473408 GTGTTTGGAGCGGTTTGGGATGG + Intergenic
1003806459 6:9730498-9730520 GTGTTGGGGTGGAGTTGGGATGG + Intronic
1004022768 6:11789752-11789774 GTCTTTGAGGGGAACTGGGAAGG - Intronic
1004101947 6:12621671-12621693 GTTGTCGGGGGGAGTGGGGAGGG + Intergenic
1004619515 6:17320781-17320803 GTCTTTGAGGGGAACTGGGAAGG + Intergenic
1005728226 6:28670656-28670678 GTTTTTTGGGGTTTTTTGGATGG + Intergenic
1005949880 6:30624083-30624105 TTTTTTGGGGGGGTGTGGGTGGG + Intronic
1006298891 6:33182885-33182907 TTTGTTGGGGGGAGTTGGGGTGG - Intronic
1007450678 6:41939042-41939064 GTTTTTGGAGGGGTTGGGGCTGG - Intronic
1007681418 6:43636154-43636176 GATAGTGGGGGGATTTCGGAGGG - Intronic
1007902759 6:45425048-45425070 GTTTTTGGGGGCTTTTGGTTTGG - Intronic
1008512285 6:52287788-52287810 GTTTTTTGGTGGAAGTGGGAAGG - Intergenic
1008732489 6:54499810-54499832 GTTGTTGGGGGGAATGGGGGAGG - Intergenic
1008770533 6:54973235-54973257 TTTTTTGGGGGGATGGGGGTGGG + Intergenic
1009437126 6:63631776-63631798 GCTTTTGGGGTCATTTGGGAGGG + Intergenic
1009735374 6:67670171-67670193 TTTTTTGGGGGGAGTTGTGGAGG - Intergenic
1009780208 6:68259852-68259874 GACTTTGGGGGAATGTGGGAAGG - Intergenic
1010236758 6:73581170-73581192 GTTTGAGGGTGGATTGGGGAGGG + Intergenic
1010311262 6:74388800-74388822 GATTTTGGGGGACCTTGGGATGG - Intergenic
1010408285 6:75531133-75531155 GTTATTGGGGTGATTTTGCAGGG - Intergenic
1010753413 6:79640105-79640127 GTTTTTGGGGGGCACTGGGGTGG + Intronic
1011052188 6:83164686-83164708 GATTTTGGAGGGATTGGAGATGG + Exonic
1011104583 6:83765610-83765632 GTTTTTGTGGGGATTTTGTTGGG - Intergenic
1013077482 6:106784210-106784232 GGTTTAGGTGGGATATGGGATGG - Intergenic
1013455704 6:110327712-110327734 CTCTTTGTGGGAATTTGGGAAGG - Intronic
1014784481 6:125602093-125602115 GTTTTTGGGGGTATTTTGGGGGG - Intergenic
1016389103 6:143557456-143557478 GCTTTGGGTGGGATTGGGGAAGG + Intronic
1017085260 6:150707643-150707665 ATTTTTGGGGGGCTTGGGGTTGG - Intronic
1017691231 6:156967151-156967173 GTCTTTTGGGGGATTTTGAAAGG + Intronic
1018989350 6:168661595-168661617 TTTTTTGGGGGGAGGTTGGATGG - Intronic
1019506726 7:1395125-1395147 GGTTATGGGGGGATTGGAGAAGG + Intergenic
1020014752 7:4824427-4824449 GTTTGTGAGGGCATCTGGGAAGG + Intronic
1020401273 7:7780303-7780325 GTCTGTGGGGGTAGTTGGGAGGG - Intronic
1020886262 7:13822464-13822486 GTTTTTGGGTGTGTCTGGGAGGG + Intergenic
1021104270 7:16618569-16618591 CTTTTTGGGGGGATTCGGGGAGG + Intronic
1021628825 7:22623520-22623542 GTGTGTGGGGGCATTGGGGAGGG - Intronic
1022010074 7:26301146-26301168 GTTTTTGGGGGGATTTGGGAAGG - Intronic
1022168471 7:27797485-27797507 GTTTTTGTGTGCATTGGGGAGGG + Intronic
1022238509 7:28486745-28486767 GCTTTTGGGAGGATTTGCAAAGG + Intronic
1022966743 7:35481318-35481340 GTGCTTGGAGGAATTTGGGATGG - Intergenic
1023322990 7:39020099-39020121 CTTTTTTGGGGGGTCTGGGAGGG - Intronic
1023327356 7:39074679-39074701 TTTTTTGGTGGGATGTGGGGTGG + Intronic
1024184974 7:46940449-46940471 GGCTTTGGGGGAATTTGGCAGGG + Intergenic
1024588655 7:50862305-50862327 AATTTTGAGGGGATTTGTGAAGG - Intergenic
1024617165 7:51125644-51125666 TATCTTGTGGGGATTTGGGAAGG + Intronic
1024894236 7:54238784-54238806 TTTGGTGGGTGGATTTGGGAGGG + Intergenic
1025935188 7:66030130-66030152 TCTTTTGGGGGGATGTGGAAGGG + Intergenic
1025936691 7:66043797-66043819 GTTTTTGGGTGGAGAAGGGAAGG - Intergenic
1026319917 7:69259355-69259377 TTTTTTGGGGGGATATGGGTAGG - Intergenic
1026537022 7:71246939-71246961 CTTTTTGGGGGGAGGGGGGAGGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027388902 7:77685902-77685924 GTTGTTGGGGTGAGGTGGGAGGG - Intergenic
1028751693 7:94390429-94390451 GTTTATGGGAGGATTTAGGATGG - Intergenic
1028942124 7:96533297-96533319 TTTTTAGGGGGAATGTGGGAAGG - Intronic
1028956656 7:96701239-96701261 ATTTTTGGGGGGGTTTTGGGGGG - Intronic
1030089277 7:105843187-105843209 GGTTAGGGTGGGATTTGGGAAGG + Intronic
1030849838 7:114470296-114470318 GTGTTTGTGAGCATTTGGGAGGG - Intronic
1031898718 7:127386174-127386196 TTTTTTGTGGGGATTGGGGTGGG - Intronic
1032171513 7:129588298-129588320 TTTTTTGGGGGGGGTGGGGATGG - Intergenic
1032297005 7:130648380-130648402 GACTTTGGGGGGATCTTGGAAGG - Intronic
1032826800 7:135578217-135578239 TTTTTTGGGGGGATTTGGAATGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034013307 7:147554409-147554431 ATTTATAGAGGGATTTGGGAAGG + Intronic
1035131623 7:156660033-156660055 GTATTTGTGGGGAGGTGGGATGG - Intronic
1035409942 7:158631526-158631548 TTTTTTGTGGGAATGTGGGAAGG - Intronic
1036126149 8:6064566-6064588 TTTTTTGGGGGGATGTGGGAAGG - Intergenic
1036460129 8:8945226-8945248 GGTTTTGGTGGGATTTTGGCAGG - Intergenic
1037086403 8:14856299-14856321 GCTTCAGGGGAGATTTGGGAAGG + Intronic
1037971664 8:23176433-23176455 TTTTGTGGGGGGCTTTGGGCAGG + Intergenic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1038788603 8:30646349-30646371 TTTTTTGGGGGGATGGGGGGAGG - Intronic
1039550734 8:38441055-38441077 GTTTTTGGGGGGTCTCGGGGCGG - Intronic
1040132804 8:43816857-43816879 TTTTTTTGGAGGATTTGTGAGGG + Intergenic
1040568215 8:48585706-48585728 GTTTCTGGGGAGATGTTGGAGGG + Intergenic
1040847992 8:51865270-51865292 TTTTTTGGAAGGATTTGAGAAGG - Intronic
1040944019 8:52863124-52863146 GTTTTTGTGGGGGCTTGTGATGG + Intergenic
1041116316 8:54541018-54541040 TTTTTTGGGGGGGTTGGGGGAGG + Intergenic
1041204799 8:55487918-55487940 ATTTTTGGTTGTATTTGGGATGG - Intronic
1042490654 8:69393894-69393916 GTTTTTGGGGGGATGCGGGTGGG - Intergenic
1042542234 8:69918918-69918940 GTGTTTGTGGGGGTTTGGGGCGG + Intergenic
1042729399 8:71914985-71915007 TTTGTTAGGGGGATTTGGGGAGG + Intronic
1043364147 8:79512261-79512283 TTTTTTGGGGGGGTATGGGGTGG - Intergenic
1045451522 8:102331541-102331563 GGTTGTTGGGGGATATGGGAAGG - Intronic
1045808230 8:106190815-106190837 TTTTTTGGGGGGGTCTGGGGGGG - Intergenic
1045843843 8:106610183-106610205 GTGTTGGTGGGGACTTGGGAGGG - Intronic
1045997902 8:108384820-108384842 TTTTTAGGGGGGATTTGTGGGGG - Intronic
1046130162 8:109956745-109956767 GTTTGTGAAGGGATTTGGAAAGG - Intergenic
1046424800 8:114032676-114032698 TTATTTGGGGGGAATGGGGATGG - Intergenic
1048145649 8:131840009-131840031 ATCTTTGGGGGGAATTAGGAAGG + Intergenic
1048948117 8:139469464-139469486 GTTTTTCTGTGGATTTGGGAAGG - Intergenic
1049572708 8:143377190-143377212 GCTTTTGGGGCGGTTTAGGACGG + Intronic
1050974956 9:11926310-11926332 GTTTTTGGGGGGAACATGGATGG + Intergenic
1051246443 9:15116589-15116611 ACTTTTGGGGGGATTTTGGCTGG - Intergenic
1051258969 9:15243241-15243263 GTTTTCTGGGAGATGTGGGAGGG - Intronic
1052299341 9:26936169-26936191 GTTTTTAGTGGAATTTGGGAAGG - Intronic
1052703042 9:31960595-31960617 GTTTTAGGGGGGATGTGGGAGGG - Intergenic
1052972972 9:34388745-34388767 GTTTTAGAGGGGTTTTAGGAGGG + Intronic
1055475399 9:76658352-76658374 CTTTTTGGGGGGGAGTGGGACGG - Intronic
1056034758 9:82592564-82592586 TTTGGTGGGGGGATGTGGGAGGG - Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056573770 9:87839081-87839103 TTTTTTGGGGGGGGTGGGGATGG + Intergenic
1056606848 9:88093025-88093047 GTTTTTAAGGGGATTTGTGGAGG - Intergenic
1057600631 9:96453974-96453996 TTGTTTTGGGGGGTTTGGGAGGG + Intronic
1058316960 9:103580662-103580684 GTTTTGGGGGACAGTTGGGAAGG - Intergenic
1058421806 9:104839997-104840019 GTTTTCTGGGGGATGTGGAAGGG - Intronic
1060488436 9:124064357-124064379 GTTTTGGGAGAGATTTGGGGTGG - Intergenic
1062308913 9:135925378-135925400 TTTTTTGGGGGGGTGGGGGATGG + Intergenic
1062586446 9:137251932-137251954 GTCTTTGGGGGGCTGTGGGAGGG + Intronic
1062695959 9:137876688-137876710 GTGTATGTGGGGATTTTGGAGGG + Intergenic
1203536331 Un_KI270743v1:43674-43696 GTTTATGGCCGGATTTGGGGAGG - Intergenic
1185989464 X:4876885-4876907 CTTTTTGGGGGATATTGGGAAGG - Intergenic
1186393195 X:9181713-9181735 GGTCCTGGGGGGATTTAGGATGG + Intergenic
1186475882 X:9857333-9857355 GATTTTAGGGGGAGTGGGGATGG + Intronic
1186858253 X:13646438-13646460 GTTGATGGGGAGAATTGGGAGGG - Intergenic
1187068307 X:15863019-15863041 TTTTTTGGGGGGGGTGGGGAAGG - Intergenic
1187627264 X:21129971-21129993 TTTTTTGGGGGGAGGGGGGAGGG - Intergenic
1187828316 X:23355025-23355047 TTTTTTGGGGGGAGGGGGGAGGG + Intronic
1187919380 X:24185950-24185972 GTTTTAGGGGGGTTTTGGGAGGG - Intronic
1188345596 X:29061460-29061482 AATTTTGGGGGGATGGGGGACGG + Intronic
1189300063 X:39946010-39946032 GTTTTGGGGGGGTTTTTGCAGGG + Intergenic
1189533096 X:41907547-41907569 ATTCTTGGAGGGATGTGGGAAGG + Intronic
1190531714 X:51385577-51385599 ATTTTTGGGGAGTGTTGGGAAGG - Intergenic
1190727957 X:53203734-53203756 GTTTTTTGGGGGATTTTTTAGGG + Intronic
1191027141 X:55925775-55925797 ATTTTTGTGGGGATAAGGGATGG + Intergenic
1191878038 X:65816157-65816179 GTTCTTGGGTGGGTTTGTGAGGG - Intergenic
1194087167 X:89542555-89542577 GTTTTAGGGGGGAGGAGGGAGGG + Intergenic
1194572543 X:95570823-95570845 CTTTTTGTGTGAATTTGGGAAGG + Intergenic
1194809157 X:98369433-98369455 GTGCTTGGGTGGATATGGGAGGG + Intergenic
1197629436 X:128841516-128841538 CTTTTTGGAGGGAATTGGGCAGG + Intergenic
1198117332 X:133556764-133556786 GTTTTTGGGGGGGTGGGGGGAGG + Intronic
1198921691 X:141735882-141735904 GTTTTTGGATGGATTTGAGTGGG + Intergenic
1198932322 X:141874861-141874883 GTTTTTGCTGTGATTTGGGTAGG + Intronic
1199412338 X:147538537-147538559 GTATTTGGGGTGATTTGGCGAGG - Intergenic
1199530608 X:148843461-148843483 CTTTTTGGGGATATTTGGCAAGG + Intronic
1200174021 X:154099137-154099159 TTTTTTGGGGGGGGTGGGGATGG + Intergenic
1200439815 Y:3198428-3198450 GTTTTAGGGGGGAGGAGGGAGGG + Intergenic