ID: 1022012414

View in Genome Browser
Species Human (GRCh38)
Location 7:26320367-26320389
Sequence CAAGGTAAACAGAAGTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 324}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022012414_1022012418 -8 Left 1022012414 7:26320367-26320389 CCATCCCACTTCTGTTTACCTTG 0: 1
1: 0
2: 3
3: 20
4: 324
Right 1022012418 7:26320382-26320404 TTACCTTGGCATATATTTTCTGG 0: 1
1: 0
2: 1
3: 24
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022012414 Original CRISPR CAAGGTAAACAGAAGTGGGA TGG (reversed) Intronic
901095765 1:6678136-6678158 CAAGTAAAACGGAAGAGGGATGG - Intronic
901732320 1:11289114-11289136 CAAGGCAGAGAGACGTGGGATGG + Intronic
902816528 1:18919475-18919497 CGAGGGAAGCAGAAGTGGGGAGG + Intronic
903865207 1:26392774-26392796 GAGGGTAAAAAGAAGTGGGTGGG + Intergenic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904702045 1:32363502-32363524 CAAGGTGGGCAGAAGTTGGAAGG + Intronic
905885837 1:41491458-41491480 GAAGGGAAGCAGAAGTGGGTGGG - Intergenic
905898084 1:41561994-41562016 CAAGGAAGAAAGAAGAGGGAAGG + Intronic
906975841 1:50572059-50572081 AAAGGAGAACAGAAATGGGAAGG - Intronic
907414803 1:54306940-54306962 CAAGGTAAGCAGTAGTTGGAGGG - Intronic
909198605 1:72659104-72659126 TAAGGGAAAAAGAAGTGGCAAGG - Intergenic
909336528 1:74480997-74481019 CAGGGTACACATGAGTGGGAGGG + Intronic
909903445 1:81167149-81167171 TAAGGTAAACATAATTAGGAGGG - Intergenic
910022657 1:82611085-82611107 TAAGGTAGAGAGAAGAGGGAAGG - Intergenic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
912440930 1:109697397-109697419 CAAAGTAACCAAAAATGGGAAGG - Intronic
913112840 1:115671596-115671618 CAAGATAAACAGCAGAGGCATGG - Intronic
913278383 1:117161275-117161297 CAAGATGAACAGCAGTGTGAAGG - Intronic
915335410 1:155138095-155138117 CATGGTAAGCACAACTGGGATGG + Exonic
915628011 1:157128078-157128100 AAAGGTACACAGATATGGGATGG + Intronic
916668173 1:166986400-166986422 CATGGGAGACAGAAGTGGGACGG + Intronic
916815361 1:168346521-168346543 ATAGGTACACAGAAGTGGGATGG - Intergenic
918434275 1:184495342-184495364 AAAGATAAACTGAACTGGGATGG - Intronic
918746024 1:188200852-188200874 TAAGGAACACAGAAGTAGGAAGG - Intergenic
919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG + Intergenic
920004632 1:202823980-202824002 GAAGGAAAGCAGAAGAGGGAAGG + Intronic
920278983 1:204829114-204829136 CGAGGTAAACAGAAGTACAAGGG - Intronic
920288910 1:204902735-204902757 AAAGGAAAAAAGAAGAGGGAAGG + Intronic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
920461531 1:206144319-206144341 CCAGGGAAACAGAAATGGGGAGG + Intergenic
921686790 1:218098499-218098521 CACGGTAAGCAGAAGTCGGAGGG - Intergenic
922356721 1:224783306-224783328 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
923156773 1:231285984-231286006 CAAAAAAAAAAGAAGTGGGATGG + Intergenic
923215683 1:231845868-231845890 CAAGGTGAAGTGAGGTGGGATGG + Intronic
923270876 1:232354022-232354044 CAAGGGTAACAGACCTGGGAGGG - Intergenic
923937868 1:238784351-238784373 AGAGGGAAACAGAAGTTGGAAGG + Intergenic
924525794 1:244846821-244846843 CAAGGAAAACCAAAGAGGGAGGG - Intronic
924656717 1:245979232-245979254 CAGGGTAAAAACAACTGGGATGG + Intronic
1064938613 10:20708004-20708026 CAAAGTGAAGAAAAGTGGGACGG - Intergenic
1065945084 10:30598945-30598967 CAAGGAGAAAAGCAGTGGGATGG + Intergenic
1067791685 10:49293141-49293163 CCAGGAACAAAGAAGTGGGATGG + Intergenic
1068262480 10:54600381-54600403 CAAGGCAAAAGGCAGTGGGAGGG + Intronic
1068908145 10:62350219-62350241 CAAGTTGATCAGTAGTGGGATGG + Intergenic
1070442104 10:76456359-76456381 CAAAGGAAATAGTAGTGGGAGGG + Intronic
1071085709 10:81866737-81866759 CCTGGAACACAGAAGTGGGAAGG - Intergenic
1073773506 10:106761029-106761051 CAAAGCAAACAGAAGTTGCAGGG + Intronic
1075546524 10:123359106-123359128 CAAGGTCAGCAGAAGTGAGTAGG - Intergenic
1076054347 10:127359177-127359199 CAAGGTGAGCAGGAGTGGGTGGG - Intronic
1077431127 11:2516520-2516542 CAAGGGCAACCGAATTGGGAAGG - Intronic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1078830433 11:14972498-14972520 CAATGCAAATACAAGTGGGACGG - Intronic
1079633618 11:22708847-22708869 CCAGGTAAACTGAAGTGTAAGGG + Intronic
1080680234 11:34469107-34469129 CCAGGAAACCAGAAGTGAGAGGG - Intronic
1083845118 11:65327148-65327170 CTAGATAAGCCGAAGTGGGAAGG - Intergenic
1084215595 11:67645423-67645445 GAAGGGAAACTGAGGTGGGAAGG + Intronic
1085792499 11:79508075-79508097 CAAGGTGAAAAAAAGTGGGATGG + Intergenic
1087257370 11:95971484-95971506 CAAGCTAAAAAAAAGTGGAAAGG - Intergenic
1087451011 11:98324639-98324661 CAAGTTAAAGAGATGTGGCAAGG - Intergenic
1089619618 11:119714735-119714757 TAAGGAAAACAGGGGTGGGAAGG + Intronic
1089997459 11:122922509-122922531 CAAGGTAAACAGCAGAGGGGAGG + Intronic
1090234123 11:125133917-125133939 AAAGGAGAACAGAAATGGGATGG - Intergenic
1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG + Intronic
1090464544 11:126922586-126922608 CAAGGTCCCTAGAAGTGGGAGGG - Intronic
1092167606 12:6352597-6352619 CAGGGTATACAGAACTGGGATGG - Intronic
1093604624 12:21074649-21074671 AAAGGTAAAAAGAAGTGCAAAGG + Intronic
1094024708 12:25950388-25950410 CATGGGAAACTGAGGTGGGAGGG + Intergenic
1094845379 12:34359159-34359181 GAAGGAAAACAGAAATGGCACGG - Intergenic
1094852123 12:34386988-34387010 GAAGGAAAACAGAAGTGGTGTGG - Intergenic
1094852429 12:34388275-34388297 GAAGATAAACAGAAGTGGCGAGG - Intergenic
1095166860 12:38983234-38983256 CTAGGGTAACAGAAGTAGGAAGG - Intergenic
1095662304 12:44751632-44751654 CAAAGTAAACACAGGAGGGAGGG - Intronic
1097728290 12:63099348-63099370 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
1098419550 12:70279562-70279584 CAAGGTAATTGGAAGTGGGTGGG - Intronic
1099147522 12:79065274-79065296 CTAGGGAAGCTGAAGTGGGAGGG + Intronic
1099381893 12:81964706-81964728 CAATATAACCAGAAGTGAGATGG + Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100942285 12:99737518-99737540 CATGGGGAAAAGAAGTGGGAAGG - Intronic
1101291864 12:103378379-103378401 CCTGGTAAAAAGAATTGGGAGGG - Intronic
1101661523 12:106769988-106770010 CAAGATAAACATTAATGGGAAGG - Intronic
1101715345 12:107306768-107306790 AAAGGTAAGAAGAAATGGGATGG + Intergenic
1102718413 12:114995126-114995148 TAAGTTAAAAAGAAGGGGGAAGG - Intergenic
1102839982 12:116108477-116108499 CATTGTCAACAGAAGTTGGAAGG - Intronic
1103368975 12:120403851-120403873 CAAGGTTAACCAATGTGGGATGG - Intergenic
1103443166 12:120978548-120978570 CAATGTAAACAGAACAGGCAGGG + Exonic
1104369866 12:128215089-128215111 CAACGGAAGCAGAGGTGGGAGGG + Intergenic
1106286212 13:28320176-28320198 CAAGGAGAAAGGAAGTGGGAGGG + Intronic
1106593244 13:31115798-31115820 CAAAGTAAACACAGGTGTGACGG - Intergenic
1107197772 13:37674331-37674353 GAAATTAAACAGATGTGGGATGG - Exonic
1108941552 13:55962285-55962307 CAAAGTAAGCAGAAGTAAGAGGG + Intergenic
1109275442 13:60298844-60298866 CAAGGTCAAAGAAAGTGGGAAGG - Intergenic
1110651105 13:77942121-77942143 CAAGGGAGACAGCAGAGGGAAGG - Intergenic
1110688601 13:78404664-78404686 CCTGGAAAACAGAAGTGGAAAGG + Intergenic
1110792101 13:79597956-79597978 CAAAGTCAACAGAATTTGGAGGG - Intergenic
1112794548 13:103041933-103041955 CAAGGTAACCAGAAGTGAAAGGG - Intergenic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1114454000 14:22843867-22843889 CAAGGTGAGAAGAAGTGGGCTGG + Exonic
1114970878 14:28026974-28026996 GAAGGAAAACAGAAGAGAGAAGG + Intergenic
1115084171 14:29493284-29493306 AAAGGGAAACAGAAGAGGAAGGG + Intergenic
1115532293 14:34338570-34338592 CAAAGTGAAAAGAAGTGGGTGGG + Intronic
1115665591 14:35541721-35541743 CAAGGTAAACAGCAATGGGAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118927333 14:70204719-70204741 CAAGGCAAAAACAAATGGGAAGG + Intergenic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121703048 14:95970642-95970664 CAAGGCAAACAGAATGGAGAAGG + Intergenic
1122013553 14:98773752-98773774 CAATGTAGAAAGAGGTGGGAAGG - Intergenic
1123887067 15:24736605-24736627 CAAGGAAAACAGAGATTGGAGGG - Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124610455 15:31204484-31204506 CCAGGTTAGCAGCAGTGGGAGGG - Intergenic
1124704152 15:31947526-31947548 CAAGGTAAAAATAATTAGGAAGG + Intergenic
1125815912 15:42584051-42584073 CCAGGCAAACAGAAGACGGAGGG + Intronic
1126377486 15:48010788-48010810 CATGGGAATCAGAAGTGGGTGGG + Intergenic
1127758855 15:62118610-62118632 CAAGGGAAGGAGCAGTGGGAGGG + Intergenic
1128451245 15:67807021-67807043 TTAGGAAAACAGAAGTGGGCAGG - Exonic
1129268666 15:74408290-74408312 CAGAGCAAACTGAAGTGGGAGGG + Intergenic
1131883263 15:96881358-96881380 GAATGTCAACAAAAGTGGGAAGG - Intergenic
1132102652 15:99035859-99035881 CAAGTTAAATAAAAGAGGGAAGG - Intergenic
1132301122 15:100776265-100776287 GAAGACAAACAGTAGTGGGATGG + Intergenic
1134621924 16:15695916-15695938 CAAGGTAAACCAAAGGGTGAAGG + Intronic
1135708712 16:24696862-24696884 CAAGGCAAAAAGAAGGGGAATGG - Intergenic
1139514316 16:67444398-67444420 AAAGGTAAGCAGCAGTGGGCAGG + Intronic
1139732883 16:68962384-68962406 GATGGTTAACAGAAGTGGGAAGG - Intronic
1143296396 17:5874925-5874947 CAAGGTTAACAGGAGAGGAAGGG - Intronic
1143448793 17:7023590-7023612 AAAGGCAAACAGAGGAGGGAAGG + Intronic
1144390469 17:14788945-14788967 CAGGGGAGACAGAAGTGAGATGG - Intergenic
1144997365 17:19279371-19279393 CAAGGTCACCAGATGGGGGAGGG + Intronic
1147250420 17:39149903-39149925 CAAGGTAAACAGGAGAGAGTTGG - Intronic
1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG + Intergenic
1148888262 17:50789164-50789186 CCAGGGAAACAGAATTGGGTAGG + Intergenic
1149378335 17:56068092-56068114 CAAGGTTAAAAGAAGTATGAAGG - Intergenic
1149513143 17:57258749-57258771 CAAGGGGGACAGCAGTGGGAAGG + Intronic
1149591318 17:57831846-57831868 CAGGGTAAAATAAAGTGGGAGGG + Intergenic
1149832239 17:59882591-59882613 AAAGGAAAAAAGATGTGGGATGG - Intronic
1149975369 17:61260478-61260500 CAAGGAAAACAACAGTGGCAGGG - Intronic
1151001132 17:70377735-70377757 CAAGACAAACAGAAGTGGGATGG + Intergenic
1152023693 17:77795323-77795345 ACAGGAAAAGAGAAGTGGGAGGG + Intergenic
1152318689 17:79595890-79595912 AATGGAAAACAGAAGTGGAATGG - Intergenic
1157500918 18:48190095-48190117 CAAGGCAGAGAGAAGAGGGACGG - Intronic
1159117367 18:64130754-64130776 CCTGGTAGACAGAAGTGGAAAGG + Intergenic
1159436996 18:68431200-68431222 CAAAGACAACAGAAGTGGGTTGG + Intergenic
1160159759 18:76462027-76462049 AAAGGTAACCGGATGTGGGAAGG - Intronic
1160478009 18:79210302-79210324 CAAGGTTGACAAAAGTGTGACGG + Intronic
1162781105 19:13007431-13007453 CAGGGCAATCAGAAATGGGAGGG - Intronic
1164518710 19:28959986-28960008 CAAGGTCTTTAGAAGTGGGATGG - Intergenic
1164856324 19:31527460-31527482 GAAGGGAAACAGAAGGGTGAGGG + Intergenic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
925625779 2:5841215-5841237 CAAAGTCAACAGAAGAGGAAAGG - Intergenic
926509895 2:13761786-13761808 CAAAGGAGGCAGAAGTGGGAAGG + Intergenic
927067828 2:19491762-19491784 GAAGAGAAACAGAAGAGGGAGGG + Intergenic
927116887 2:19913299-19913321 CAAGATAAACAAAAGAGAGAGGG + Exonic
930578252 2:53178873-53178895 CAAGGTAAACTGCAGTGGTTTGG - Intergenic
930696552 2:54417217-54417239 GAAAGGAAACAGAAGTAGGAGGG + Intergenic
932289797 2:70567177-70567199 CAAGATAAAAAGAAGTGGGAAGG - Intergenic
932531537 2:72539196-72539218 AAAGGAAAAAAGAAGGGGGAGGG + Intronic
932624529 2:73286778-73286800 GAAGGGAAACAGAAAGGGGAAGG - Intergenic
933312806 2:80681939-80681961 CAGGGTAAAGAGAGGTGAGAAGG + Intergenic
934160252 2:89242993-89243015 CAATGTAGATAGAAGTGGAAAGG + Intergenic
934207024 2:89939440-89939462 CAATGTAGATAGAAGTGGAAAGG - Intergenic
935451846 2:103218733-103218755 TCAGGTTAACACAAGTGGGAGGG - Intergenic
935503348 2:103869212-103869234 GAAGGAAATCAGCAGTGGGAAGG - Intergenic
937378673 2:121355774-121355796 CAAGGTGGCCAGAAGTGGCAAGG + Intronic
937868110 2:126768979-126769001 AAAAGTAAACAGAAGAGGTAGGG + Intergenic
938091720 2:128438801-128438823 CAAGATCAACAGAAGAGGGATGG + Intergenic
938505435 2:131875831-131875853 GAAGGAAAAAAGAAGTGAGAGGG - Intergenic
938590106 2:132728014-132728036 CAAGGGCAGCAAAAGTGGGAAGG + Intronic
939237091 2:139508733-139508755 CAAGGCATACAGAGGAGGGAGGG + Intergenic
939869591 2:147512132-147512154 CAAGGAAACCAGCAATGGGAAGG - Intergenic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940983114 2:160024711-160024733 CAAGGGAAACAGCATTGGCAAGG + Intronic
941087601 2:161135440-161135462 CAAAGTAAATAGAGGAGGGAGGG + Intergenic
941371063 2:164665032-164665054 AAAGGAAAACAAAAGTGGGTCGG + Intronic
942094534 2:172524725-172524747 AAAGGGAAAGAGAAATGGGATGG - Intergenic
942821899 2:180124661-180124683 CCAGGTAAGAAGAAGTGGTATGG - Intergenic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
945003660 2:205378391-205378413 TAAGGGAAACAGAGGTGGAAGGG + Intronic
946277533 2:218642731-218642753 CAAAGTGGACAGAAGTGGGTAGG + Exonic
947941201 2:234057152-234057174 CAAGGTAAACAGATTGGGGCAGG - Intronic
948287948 2:236801583-236801605 CAAGGTAACGAGATGTGTGATGG + Intergenic
1168922604 20:1552921-1552943 CAAGGGAAACATTACTGGGAAGG + Intronic
1169178366 20:3539758-3539780 CCAGGAAAAAAAAAGTGGGAGGG - Intronic
1169567349 20:6869481-6869503 AAATGGAAACAGAGGTGGGAAGG - Intergenic
1170401950 20:15996012-15996034 ATATGTAACCAGAAGTGGGATGG + Intronic
1170657068 20:18297957-18297979 TAAGGAAAACAGAAATGGGAGGG - Intronic
1171073780 20:22102258-22102280 CATGGGAATCAGAACTGGGATGG + Intergenic
1171473169 20:25388446-25388468 CAAGGTCGACAGGAGTGGGCTGG + Intronic
1172799923 20:37568519-37568541 AAAGGTGACCAGAAGTGGCATGG + Intergenic
1173753926 20:45498243-45498265 CAAAGTAAATACAAATGGGAAGG + Intergenic
1174131173 20:48344221-48344243 CTAAGGAAATAGAAGTGGGAGGG + Intergenic
1175045586 20:56101911-56101933 GAAGGAAAACAGGAGGGGGAAGG + Intergenic
1175956022 20:62609861-62609883 CCAGGTAAACAGAAGCTGGAAGG + Intergenic
1176051888 20:63124308-63124330 CAAGCTAAACATACCTGGGAGGG - Intergenic
1177213565 21:18100297-18100319 GAAGGCAAACAGAAGTGAGCAGG + Intronic
1178031724 21:28535297-28535319 GAAGGAAAACAAAAGGGGGAGGG + Intergenic
1178361052 21:31948720-31948742 CCAGGGAAACAGAAGCTGGAAGG + Intronic
1178485318 21:33015831-33015853 GGAAGTAAACAGAAGTGGCATGG - Intergenic
1178514298 21:33232907-33232929 CAAAGTGAACAGAAATGGTAAGG + Intronic
1179938348 21:44620071-44620093 GAATGTAAAAAGCAGTGGGACGG + Intronic
1181180568 22:21065251-21065273 GAAGGTAAATAGAAGGGAGAAGG - Intergenic
1181473317 22:23153983-23154005 GAAGACAAACAGAAGTGGGCCGG - Intronic
1181479771 22:23191262-23191284 CAAGATAAACAGAAAAGAGATGG - Intronic
1181823857 22:25497362-25497384 CATGATAAACAGCAGTGAGAGGG + Intergenic
1182137959 22:27923395-27923417 GAAGATAAAAAGAAATGGGATGG - Intergenic
1182478467 22:30590242-30590264 CGAGGGATACAGAAGTGTGAGGG - Intronic
1183364015 22:37397740-37397762 CAATGTAAGAAGAAGTGGGCAGG - Intronic
1184593451 22:45500777-45500799 AAAGGTGAGCAGAGGTGGGAAGG - Intergenic
949174944 3:1049809-1049831 TAAGATATACACAAGTGGGAAGG + Intergenic
949230528 3:1744846-1744868 GAAGATAAAAAGATGTGGGAAGG - Intergenic
949354191 3:3160432-3160454 CATGGTAATAAGAACTGGGATGG + Intronic
952982046 3:38744208-38744230 TAAGATAAACTGGAGTGGGAGGG + Intronic
953196550 3:40739516-40739538 CAAGGCAAAGAGGAGAGGGAAGG - Intergenic
953283737 3:41583857-41583879 AAAGGTACACAAATGTGGGATGG + Intronic
953313841 3:41907402-41907424 CATGGGAAGCTGAAGTGGGAGGG - Intronic
953474703 3:43195474-43195496 CAAGGGAAACAGAGGTGGGGAGG - Intergenic
953722363 3:45367579-45367601 CAAGGCAAACAGGAGTGACACGG - Intergenic
954867688 3:53743835-53743857 TAAGCTAAAGAGAAGTGGAAAGG + Intronic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
956223749 3:66933344-66933366 CAAGGTAAGCAGAAGGGACAAGG - Intergenic
956619662 3:71208769-71208791 TAACGTAAACAGAACTGGGGAGG + Intronic
956626674 3:71273535-71273557 CAAGGAAGACTGAAGGGGGATGG - Intronic
956686956 3:71838638-71838660 CAGGGCAACTAGAAGTGGGAGGG - Intergenic
957501420 3:81062911-81062933 CAAGGTAAAAATATGTGGGCTGG - Intergenic
960545502 3:118910085-118910107 CAGAGTCAACAGAAGTGGGTAGG - Intronic
960584452 3:119308109-119308131 CAAGGTGATCAGAAGAGTGAAGG + Intronic
961021751 3:123513437-123513459 CAACGTCACCAGGAGTGGGAAGG + Intronic
961134438 3:124496646-124496668 AGAGTTTAACAGAAGTGGGAAGG + Intronic
962268163 3:133958201-133958223 CAAGGCTAACAGATGTTGGAAGG + Intronic
962753479 3:138451319-138451341 CAAGGTGGGCAGAGGTGGGAGGG + Intronic
965202750 3:165680987-165681009 AAAGGGGAACAGGAGTGGGAAGG - Intergenic
965524627 3:169702694-169702716 CAAGGGAAAGAGAGGTGTGATGG - Intergenic
965983711 3:174725363-174725385 CTAGGTAAATAAAAGTGGGATGG - Intronic
966301225 3:178481488-178481510 CAAGATAAACAGAGTTGGGAAGG + Intronic
966829792 3:183997746-183997768 GAATCTAAACAGAAGTGGAATGG - Intronic
970172448 4:13303418-13303440 CAAGATGCACACAAGTGGGATGG - Intergenic
971935852 4:33146027-33146049 TAAGGTAATCATCAGTGGGATGG + Intergenic
972899324 4:43663301-43663323 CAATTTAAACAGAAGCGGGAAGG - Intergenic
974560765 4:63514440-63514462 CAAGGAAATCAGCACTGGGATGG + Intergenic
975662241 4:76699363-76699385 AAAGGTAAAAAGCAGGGGGAGGG - Intronic
975948489 4:79738467-79738489 CAAGGTAAAAGGAATTGAGAGGG - Intergenic
976080078 4:81345924-81345946 CAAAGGAAACAGAGGTGTGATGG - Intergenic
976536211 4:86221195-86221217 CAAACTAAACAGAAGTGAGGAGG + Intronic
979999246 4:127469446-127469468 CTTGGTAAAAAGAAGAGGGAGGG - Intergenic
980708952 4:136539171-136539193 CAAAGTCAACAGAAGTGCCAGGG + Intergenic
980741834 4:136960603-136960625 CATGGTAAACAGAACGGTGAGGG - Intergenic
982925886 4:161336433-161336455 CAAAGTAACCAGAGGTGAGAAGG + Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983337173 4:166411756-166411778 CAAGCTATGAAGAAGTGGGAAGG - Intergenic
984048278 4:174829998-174830020 CAAAGTAAATAAATGTGGGAGGG - Intronic
984827107 4:183935483-183935505 AAAGGGAAACTGAAGTGAGAGGG + Intronic
985102235 4:186470002-186470024 CAAGGAAAAAAGAAGACGGAGGG + Intronic
985186751 4:187325798-187325820 CTAGGTAAGCAGAGGTGGGTAGG - Intergenic
985493057 5:190312-190334 AAAGAGAAACAGCAGTGGGAGGG - Intergenic
986840842 5:11695476-11695498 CGAGGAAAAGAGAAGTGGTAGGG - Intronic
987057896 5:14212401-14212423 CAAGGTTCACAGAAGTTGGCTGG - Intronic
987458775 5:18180748-18180770 CAGAGTAAACAGAGGTGGTAAGG - Intergenic
987534764 5:19170410-19170432 TAAGGTAACCAGAATTTGGAAGG + Intergenic
988219338 5:28321889-28321911 AAATATAAATAGAAGTGGGATGG - Intergenic
988349951 5:30089518-30089540 CAAAGCAGTCAGAAGTGGGATGG + Intergenic
989844540 5:46124651-46124673 CAAGGTAAAAACAAGAAGGAAGG - Intergenic
990918110 5:60932871-60932893 AAAGGGAAAGAGAAGAGGGAAGG + Intronic
995120264 5:108529011-108529033 CAAGATAAAAAGAAGGGGAAAGG + Intergenic
998156831 5:139791932-139791954 ATAGGTAAAGAGAAATGGGATGG + Intergenic
998189495 5:140011006-140011028 CAGGACAAACAGTAGTGGGAGGG - Intronic
999650545 5:153763188-153763210 CAAGGTAAAGTGAAGTGTCAAGG + Intronic
1001141034 5:169144263-169144285 CAAGGTAAACATGGGAGGGAAGG - Intronic
1001555035 5:172631340-172631362 CAAAGCAAACAGGAGTGGCAGGG + Intergenic
1001881464 5:175248063-175248085 CTAGATAAAGACAAGTGGGAGGG + Intergenic
1004319652 6:14622378-14622400 CAAGGGAAAGAGAAGTCAGAAGG + Intergenic
1004501669 6:16215638-16215660 CAAGCTTAACAGAAGTGGCCAGG + Intergenic
1005290946 6:24378273-24378295 CATGGCACACAGAAGCGGGAGGG - Intergenic
1006962148 6:37943823-37943845 CAAAGTAAACTGAAGTGGTGAGG + Intronic
1007267756 6:40610044-40610066 GAATGGAGACAGAAGTGGGAGGG - Intergenic
1007459672 6:42009048-42009070 TAAGGTATACAGAAGTGTAAGGG + Intronic
1008335659 6:50301773-50301795 CATAGTAAACAGAAATGGGATGG - Intergenic
1008849317 6:56005598-56005620 AAAGGAAAACAGAAATGAGAAGG - Intergenic
1009053686 6:58310257-58310279 GAAGGCAAACAGAAGAGGTAAGG - Intergenic
1011094679 6:83647157-83647179 AAAGGTATACAGATTTGGGATGG - Intronic
1011714873 6:90094785-90094807 CAGGGGAACCAGAAGTGGCATGG - Intronic
1011938309 6:92810707-92810729 CAAGGTCAACAGATGTAGGTGGG + Intergenic
1012254761 6:97018724-97018746 CAAGATGAACAGAATTGGAAGGG + Intronic
1013800268 6:113933519-113933541 GAATGGAAATAGAAGTGGGAAGG - Exonic
1016769703 6:147835590-147835612 CGGGGTAAACAGAAATGGCATGG - Intergenic
1016772405 6:147866428-147866450 CAATGTAATGAAAAGTGGGACGG + Intergenic
1016914846 6:149235289-149235311 CAAGGAAAACAGAATTTTGAAGG + Intronic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1020991821 7:15207482-15207504 CAATGTAAATAGAAGTGTGTCGG - Intronic
1021312396 7:19110627-19110649 GAAGGAAAACAGGAGGGGGATGG + Intronic
1021593995 7:22295145-22295167 CTATGAAAAAAGAAGTGGGATGG + Intronic
1021707972 7:23386769-23386791 CAAGGTTAACATCAGTGGGCTGG + Intronic
1022012414 7:26320367-26320389 CAAGGTAAACAGAAGTGGGATGG - Intronic
1022446037 7:30471590-30471612 AAAGGTGAACAGAGCTGGGAAGG + Intronic
1022673479 7:32477341-32477363 GAGGGTAATAAGAAGTGGGAAGG - Intergenic
1024571172 7:50723852-50723874 CAAGGCAAACAGACATAGGAAGG + Intronic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1026645145 7:72160994-72161016 CAAGTTAAACAGAAGCTGGCAGG + Intronic
1027894381 7:84022757-84022779 AAAGGTAAATAGAATTGAGAAGG + Intronic
1028187163 7:87800499-87800521 TCAGGTACCCAGAAGTGGGATGG + Intronic
1030745257 7:113158044-113158066 AAAGGTAAAAAGAAATGTGAAGG - Intergenic
1032200611 7:129820051-129820073 CTGGGTACACAGAAGTGGGGAGG + Intergenic
1032894004 7:136230906-136230928 AAAGGTATGCAGAATTGGGAAGG - Intergenic
1033009479 7:137604888-137604910 TAAGGCAAACAGAAGTGTAAGGG + Intronic
1033046487 7:137967098-137967120 CAGGGCAAAGAGGAGTGGGAAGG - Intronic
1033545674 7:142397894-142397916 CAAGGAAAACAAAATAGGGAAGG - Intergenic
1033608786 7:142946129-142946151 CAAAGTTAATAGAAGAGGGAAGG + Intronic
1033788994 7:144768574-144768596 CAAGGTAAAATAAAGTGAGAGGG + Intronic
1034407293 7:150913564-150913586 CTAGGTAGAAAGAAATGGGAAGG + Intergenic
1034706027 7:153145319-153145341 CAAGTTACACAGAACTGGGGTGG + Intergenic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036694827 8:10967624-10967646 CAAGGTAACAAGAGGTGGGGAGG + Intronic
1037495826 8:19439879-19439901 CAAAGTAAACAACAGTGAGATGG + Exonic
1037731533 8:21528792-21528814 AAAGGAAAATAGGAGTGGGAGGG - Intergenic
1038019090 8:23537889-23537911 CAAGGCAAACAGAAGTGCTGAGG - Intronic
1038148300 8:24918303-24918325 CAAGGAAAAAGGCAGTGGGAGGG + Exonic
1038174942 8:25173204-25173226 CTAGGGAAACTGAGGTGGGAGGG + Intergenic
1040611479 8:48987754-48987776 CAAGTATAACAGAAGTGTGAAGG - Intergenic
1040710121 8:50177618-50177640 CAAGTGAAACAGGAGTGGGCTGG + Intronic
1041056101 8:53987988-53988010 CAAGCTAAGCAGCAGTGGGTGGG + Intronic
1042040807 8:64586620-64586642 CATGGAAAGCAGGAGTGGGAGGG + Intergenic
1043689841 8:83136843-83136865 CAAGGAAAAAGGAAGTGGAAGGG + Intergenic
1043775260 8:84259310-84259332 CATGGAATACAGAAGTTGGAGGG - Intronic
1043829294 8:84968804-84968826 CAAGAAAAAAAGAAGTGGCAGGG + Intergenic
1045218509 8:100173854-100173876 CAAGATAAATAAAAGTAGGAAGG + Intronic
1046669174 8:117038860-117038882 CAAGGCAAACACTTGTGGGATGG - Intronic
1047024850 8:120813235-120813257 GAGGGTAGACAGCAGTGGGAAGG - Exonic
1048045572 8:130769607-130769629 GATGGGAAACAGAAGTGTGAGGG + Intergenic
1049840385 8:144767317-144767339 CATGGGAAGCAGAGGTGGGAGGG - Intergenic
1051106639 9:13587893-13587915 CAAGGAGACCAGAAGTGGGATGG - Intergenic
1051265409 9:15304790-15304812 CAAGGTCAACAGTCATGGGAAGG + Intronic
1053306797 9:36990084-36990106 CCAGGTAAACAGTAGGGTGAGGG + Intronic
1055093262 9:72384340-72384362 CAAGAGGAAGAGAAGTGGGAGGG - Intergenic
1056722976 9:89087432-89087454 AGAGGAAAACAGAAGTGTGATGG + Intronic
1056887560 9:90457823-90457845 CTAGGAAAACAGAAGTGAAAAGG - Intergenic
1057006122 9:91561879-91561901 TTAAGAAAACAGAAGTGGGATGG + Intergenic
1060378833 9:123145089-123145111 CAAGGTAAATAAAAGTAAGAAGG + Intronic
1186539361 X:10384398-10384420 CAAGGAAGAGAAAAGTGGGAAGG - Intergenic
1186614640 X:11173824-11173846 GAAGGAAAACAGAGTTGGGATGG - Intronic
1187411347 X:19053203-19053225 GAAGGAAATCTGAAGTGGGAAGG + Intronic
1187593754 X:20747559-20747581 CAAGGTAATCCGAAGGGGGCAGG - Intergenic
1187948118 X:24446240-24446262 CAATGGAAACAGAGGTTGGAGGG + Intergenic
1189944548 X:46164715-46164737 CAAGGCAATCAGAAATGTGATGG - Intergenic
1190031548 X:46977949-46977971 CTAGGTAAACAGGATTGGGTGGG + Intronic
1190441193 X:50475960-50475982 GTAGGTAAGCAGGAGTGGGATGG + Intergenic
1190961911 X:55259727-55259749 CAAGATAAACATAAGGGAGAAGG - Intronic
1191652783 X:63559518-63559540 GAAGGAAAGCAGAAGTGGGGAGG + Intergenic
1191706595 X:64100522-64100544 CAAGATAAACAGAAGAGTGTGGG + Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1195431185 X:104791236-104791258 TGAGGTAAACAGATGGGGGAGGG - Intronic