ID: 1022018217

View in Genome Browser
Species Human (GRCh38)
Location 7:26372542-26372564
Sequence TAAAGTAAATACAGCTCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022018215_1022018217 23 Left 1022018215 7:26372496-26372518 CCTCTGGGCTTGGACACAGTAGT 0: 1
1: 0
2: 0
3: 18
4: 181
Right 1022018217 7:26372542-26372564 TAAAGTAAATACAGCTCCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022018217 Original CRISPR TAAAGTAAATACAGCTCCGC AGG Exonic
906055126 1:42909880-42909902 TAAGGGAAATACAGGTCCCCTGG - Intergenic
910863923 1:91769950-91769972 CAAAGTAAACACTGCTCCTCAGG + Intronic
915074716 1:153298717-153298739 TAAAGCAGATACAGCACCACTGG + Intronic
915392273 1:155554843-155554865 TAAAGTAAATTAAACTCAGCTGG + Intronic
916727995 1:167540451-167540473 TGGAGTAAATGCAGCTCAGCAGG - Intronic
919328903 1:196143963-196143985 TAAAGGATAGACAGCTCCTCTGG + Intergenic
922512282 1:226179167-226179189 TAAAATAAATACTGCTCCTTAGG + Intronic
924754348 1:246928019-246928041 TAAATTAAATACTGTTCGGCCGG + Intronic
1063836698 10:10022665-10022687 TAAAGCAAATACACCTACTCAGG + Intergenic
1064586087 10:16840627-16840649 TAATGAAAATATAGCTCCTCCGG - Intronic
1070703665 10:78621675-78621697 TACTGTAAATACAGGTCAGCTGG + Intergenic
1072359784 10:94648151-94648173 TTAAGTAAATACAGCTTCATTGG + Intergenic
1073000936 10:100285929-100285951 GAAAGAAAATACAACTCTGCAGG - Intronic
1076126483 10:127978171-127978193 TAAAGGAATTACAGCTTCACTGG + Intronic
1078185269 11:9046686-9046708 AAAAGTAAAAACAGCCCAGCTGG - Intronic
1078855576 11:15204301-15204323 TAATGTAATTCCAGCTCTGCTGG + Intronic
1085830026 11:79889872-79889894 TAAAGAAAATAAAGCTCTGAGGG - Intergenic
1086134320 11:83431428-83431450 TAAAGTAAATAAATCTTTGCTGG - Intergenic
1087167529 11:95020209-95020231 TAAAGTAAATAAATCTTTGCTGG - Intergenic
1095459213 12:42424560-42424582 TAATGTAAATACAGCTTCAGGGG + Intronic
1097439873 12:59596233-59596255 TAAAGTAAGTACAGCTGGGGAGG + Intronic
1100384125 12:94090270-94090292 TAAAGTAAATACAGCTTAAGTGG - Intergenic
1102650647 12:114439943-114439965 GAAAATAAACACAGCTCCCCCGG + Intergenic
1110364887 13:74671186-74671208 GAAAGTATATACAGCTCTGGTGG - Intergenic
1113148707 13:107238427-107238449 TCAGGTAAATGCAGCTCTGCCGG + Intronic
1113347724 13:109496886-109496908 TGAAGTAAAGAGAGCTCCACTGG + Intergenic
1122601715 14:102924965-102924987 GACAGTAAATACAGCTTCACTGG + Intronic
1127206493 15:56725576-56725598 TGAAGAAAATACAGCTTCACAGG + Intronic
1129786036 15:78310789-78310811 TAGTGTAAATACAGCTCCCATGG + Intergenic
1132091073 15:98948356-98948378 TAAACTAAATTCAGCCCCGGTGG - Intronic
1133110597 16:3545853-3545875 TAAAGTACACACAGCCCCTCAGG - Intronic
1133508705 16:6437253-6437275 TAAAGTAAATGCAGGTCAGTAGG - Intronic
1138872950 16:60914763-60914785 TAAAGGAATTACAGGACCGCTGG - Intergenic
1146166819 17:30596174-30596196 TAAAGTAAAGACAGGTTGGCCGG + Intergenic
1146192696 17:30784112-30784134 TAAAGCAATTACAACTACGCTGG + Exonic
1146276866 17:31521830-31521852 TCAAGTAAAGTCAGCTCAGCAGG + Intronic
1150849228 17:68688629-68688651 CAAGGTAAATACAGCTTTGCAGG - Intergenic
1153744087 18:8159288-8159310 TAAAGTAAATAAAGCTTCACTGG + Intronic
1158870995 18:61688019-61688041 TCAAGTTAATCCAGCTCCTCTGG - Intergenic
1164148271 19:22526546-22526568 AAAAATAAAAACAGCTTCGCCGG + Intronic
930154644 2:48093566-48093588 TGGAGTAAATACAGCTTTGCTGG - Intergenic
930325220 2:49908033-49908055 TTAAGTAAAGTCAGCTCTGCCGG + Intergenic
936953556 2:118002411-118002433 TAAAGTTAAAACAGCCCCCCAGG + Intronic
940882762 2:158962900-158962922 TAAGTTAAATACAGCTTCCCAGG + Intergenic
1168756542 20:322316-322338 TAAAGAAAATAAAGCTGGGCTGG - Intergenic
1168793879 20:598269-598291 TAAAATAAATACAGCTTCGCGGG - Intergenic
1176990499 21:15490764-15490786 AAAAATAAATAAAGCTCCGAAGG - Intergenic
1184353216 22:43958775-43958797 TAATGTAAAAAGAGCTCCACAGG - Intronic
1185161267 22:49231326-49231348 AAAAGTAAATACAGCTCTGCTGG - Intergenic
952311671 3:32196302-32196324 TAAAATAAATACAGCTGCACAGG + Intergenic
952345736 3:32483017-32483039 TAAAATTAATACAGCTCTGTGGG - Exonic
954815225 3:53275004-53275026 AAAAGTAAAGACAGCTAGGCTGG - Intergenic
957490383 3:80919094-80919116 TAAAGTAAAAACAGCTATGCAGG - Intergenic
962543042 3:136402510-136402532 TAAAGTAAAATCAGCTAGGCCGG - Intronic
968839912 4:2995702-2995724 TAAAGTAAAGACAGCTGCGTGGG + Intronic
974587717 4:63901001-63901023 ATAAATAAATACAGCTCTGCTGG + Intergenic
975717265 4:77217070-77217092 AGAGGTAAATACAGCTCAGCTGG + Intronic
978647334 4:110951700-110951722 TAAAGTAAATACATCATCACTGG + Intergenic
980342559 4:131569085-131569107 TGAAGCAAATACAGTTCCCCTGG - Intergenic
980393175 4:132171986-132172008 TAAAGTAACTTCATCTCGGCCGG + Intergenic
981435558 4:144717131-144717153 TAAAATAAATACAGTTTCACTGG + Intronic
984339603 4:178438964-178438986 TAAAGAAAATAAAACTCAGCCGG - Intergenic
987373438 5:17213895-17213917 GAAAGTAAATTCAGCTCTACTGG - Intronic
990086214 5:51981262-51981284 TAATGTTAACACAGCTCCACGGG - Intergenic
992349488 5:75914434-75914456 TAGTGAAAATACAGCTCCACAGG + Intergenic
1001596844 5:172903896-172903918 TAAAGAAAATACAGCAGTGCAGG - Intronic
1004403824 6:15313117-15313139 TAATGTAAAAAAAGCTCCGACGG - Intronic
1004966968 6:20863070-20863092 TAAAGTGCATACAGATCCCCTGG + Intronic
1009409372 6:63348125-63348147 TAACGTAAATACAGCAGCTCAGG + Intergenic
1009594885 6:65722345-65722367 TAAATTTAATACAGCTCAGAAGG - Intergenic
1010373373 6:75137633-75137655 TAAAATATATACAGCTCCCAAGG + Intronic
1010752370 6:79630367-79630389 AAAAGTAAATACAGTACAGCAGG + Intergenic
1016035632 6:139380091-139380113 TAAAAAATATACAGCTCCTCAGG - Intergenic
1021299613 7:18956736-18956758 TAGACTAAAAACAGCTCCCCTGG - Intronic
1022018217 7:26372542-26372564 TAAAGTAAATACAGCTCCGCAGG + Exonic
1022300746 7:29100000-29100022 TAAACAAAACACAGCTCCACAGG - Intronic
1026304512 7:69128740-69128762 CAAAGTAAATAAAGCTCTGTAGG - Intergenic
1031252396 7:119403355-119403377 TAAAGTAAATATATTTCCTCTGG + Intergenic
1035660754 8:1346085-1346107 TAAGGGAAATGCAGCTCTGCCGG - Intergenic
1036070509 8:5437252-5437274 TAAAGTAAATAAACCTCTGCTGG - Intergenic
1040806052 8:51397637-51397659 TAAAGAAAAAATAGCTCTGCAGG + Intronic
1041421730 8:57674212-57674234 TAAAGTAGGTACAGATCCACTGG - Intergenic
1043925889 8:86036760-86036782 TAAAGTAAATAAAGAGCCTCAGG + Intronic
1044730868 8:95227684-95227706 AAAAGTAAATAAAGCTTCACAGG - Intergenic
1047355050 8:124112382-124112404 TAAATGAAAAACAGCTCCACGGG + Intronic
1050513794 9:6421049-6421071 TAAAGTAAAGAAAGCTCCGAGGG + Exonic
1050662704 9:7900444-7900466 TAAAGTATATATAGTTCAGCAGG - Intergenic
1053373246 9:37580363-37580385 CAAAGTAAATAAAGCTCCCATGG - Intronic
1055536886 9:77256990-77257012 TAAAGTAAATACAGATGGGGAGG + Intronic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1187701270 X:21966457-21966479 TAAAGTACATTAACCTCCGCAGG - Intronic
1188611411 X:32103003-32103025 TAACCTAAATGCAGCTCCGTTGG - Intronic
1197479186 X:126961963-126961985 TAAGGTAAATACAGTTCCCTTGG - Intergenic