ID: 1022020789

View in Genome Browser
Species Human (GRCh38)
Location 7:26398172-26398194
Sequence AAGGCCCAGGGTTCGGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022020781_1022020789 4 Left 1022020781 7:26398145-26398167 CCTCGGTGGCCACACGGGGAGCT No data
Right 1022020789 7:26398172-26398194 AAGGCCCAGGGTTCGGGAGGCGG No data
1022020776_1022020789 18 Left 1022020776 7:26398131-26398153 CCGCACGCGGCTTGCCTCGGTGG No data
Right 1022020789 7:26398172-26398194 AAGGCCCAGGGTTCGGGAGGCGG No data
1022020773_1022020789 22 Left 1022020773 7:26398127-26398149 CCTCCCGCACGCGGCTTGCCTCG No data
Right 1022020789 7:26398172-26398194 AAGGCCCAGGGTTCGGGAGGCGG No data
1022020772_1022020789 23 Left 1022020772 7:26398126-26398148 CCCTCCCGCACGCGGCTTGCCTC No data
Right 1022020789 7:26398172-26398194 AAGGCCCAGGGTTCGGGAGGCGG No data
1022020775_1022020789 19 Left 1022020775 7:26398130-26398152 CCCGCACGCGGCTTGCCTCGGTG No data
Right 1022020789 7:26398172-26398194 AAGGCCCAGGGTTCGGGAGGCGG No data
1022020783_1022020789 -5 Left 1022020783 7:26398154-26398176 CCACACGGGGAGCTCAGCAAGGC No data
Right 1022020789 7:26398172-26398194 AAGGCCCAGGGTTCGGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022020789 Original CRISPR AAGGCCCAGGGTTCGGGAGG CGG Intergenic
No off target data available for this crispr