ID: 1022021468

View in Genome Browser
Species Human (GRCh38)
Location 7:26403448-26403470
Sequence CCTGGGAGGCAGAAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022021468_1022021475 16 Left 1022021468 7:26403448-26403470 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1022021475 7:26403487-26403509 GCCTCAGCTTCCTGAGTAGCTGG 0: 3518
1: 93577
2: 199124
3: 230108
4: 153746
1022021468_1022021477 17 Left 1022021468 7:26403448-26403470 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1022021477 7:26403488-26403510 CCTCAGCTTCCTGAGTAGCTGGG 0: 4530
1: 106697
2: 211111
3: 239384
4: 147452
1022021468_1022021478 25 Left 1022021468 7:26403448-26403470 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1022021478 7:26403496-26403518 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022021468 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG (reversed) Intergenic
Too many off-targets to display for this crispr