ID: 1022021719

View in Genome Browser
Species Human (GRCh38)
Location 7:26406096-26406118
Sequence CATCTGTCCCACATTGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022021716_1022021719 -7 Left 1022021716 7:26406080-26406102 CCTCCGAGAGTCAAGCCATCTGT No data
Right 1022021719 7:26406096-26406118 CATCTGTCCCACATTGATATTGG No data
1022021717_1022021719 -10 Left 1022021717 7:26406083-26406105 CCGAGAGTCAAGCCATCTGTCCC No data
Right 1022021719 7:26406096-26406118 CATCTGTCCCACATTGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022021719 Original CRISPR CATCTGTCCCACATTGATAT TGG Intergenic
No off target data available for this crispr