ID: 1022022503

View in Genome Browser
Species Human (GRCh38)
Location 7:26414421-26414443
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 6, 1: 16, 2: 61, 3: 95, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022022503 Original CRISPR GGTTTCAGGCATCCACTGGA GGG Intergenic
900825773 1:4925566-4925588 GGGTTCAGTGATTCACTGGAAGG - Intergenic
904109592 1:28115242-28115264 GTTTTTAGGCATCTATTGGAGGG - Intergenic
904519560 1:31084206-31084228 AGTTTCAGGCATTCACTGGGAGG - Intergenic
905415454 1:37800700-37800722 GGGTTCAGGAATCTACTGGGAGG - Exonic
906428857 1:45738088-45738110 AGTTTCAGGCATCCACTGGGGGG + Intronic
906758142 1:48341893-48341915 GGTTTCAGGCATCCACTAAGGGG + Intronic
909358464 1:74734608-74734630 GGTTTCAGGCATCCACTAGGGGG + Intronic
909580152 1:77224269-77224291 GATTTCAGGTATCCACTGGGGGG - Intergenic
910415880 1:86997672-86997694 GGTTTCAGGCATCTACTGGGGGG - Intronic
912871068 1:113307144-113307166 GGTTTCAGGCAACCACTGGGGGG - Intergenic
912891898 1:113542145-113542167 GGTTTCCGGCATCCACTGGGGGG - Intronic
913488092 1:119352292-119352314 AGTTTTAGGCATCCACTGGGAGG + Intergenic
913584167 1:120256964-120256986 AGTTTGAGGCATCCAAAGGAGGG - Intergenic
913624013 1:120641376-120641398 AGTTTGAGGCATCCAAAGGAGGG + Intergenic
914566158 1:148868832-148868854 AGTTTGAGGCATCCAAAGGAGGG - Intronic
914606663 1:149261408-149261430 AGTTTGAGGCATCCAAAGGAGGG + Intergenic
914829034 1:151157248-151157270 AGGTTCAGGTTTCCACTGGAAGG + Intronic
917764106 1:178198767-178198789 GGGGTCAGGCACCCACTTGAGGG + Intronic
917857795 1:179115663-179115685 GGTTTCAGGCATCCAAGGGGGGG + Intronic
919110346 1:193211161-193211183 GGTTTCAGGTATCCGCTGGGGGG - Intronic
919151384 1:193704598-193704620 GGTTTCTGGCATTCCCCGGAGGG + Intergenic
920054871 1:203184492-203184514 GGTCTCCCGCATCCACTGTATGG - Intronic
920543049 1:206793660-206793682 GGTTCCAGGCATAAAATGGAGGG - Intergenic
920711617 1:208300978-208301000 GGTTTTGGGCATCCACTGCGGGG + Intergenic
920986235 1:210892259-210892281 AGTTTCAGGCATCCAGGGAATGG - Intronic
921912059 1:220560290-220560312 AGTTTCAGCCATCCACTGGGGGG - Intronic
922184800 1:223264806-223264828 GGTCTCAGGCAGCCTGTGGAAGG + Exonic
922307322 1:224355811-224355833 CGTGTCAGGCATCCACTTGGGGG + Intergenic
924863183 1:247948745-247948767 AGTTTCAAACATCCACTGGGGGG + Intronic
924866655 1:247990155-247990177 AATTTCAGGCATTCACTGGCGGG + Intronic
1064031090 10:11883334-11883356 GGTCTCATGGATTCACTGGAGGG + Intergenic
1064183538 10:13140732-13140754 GGCTGCAGGCAGACACTGGAAGG - Intergenic
1065010191 10:21414115-21414137 GGTTTCAGACTTCCACTGGGGGG - Intergenic
1065436908 10:25712189-25712211 GGTTTCAGGCATCCACTAGTGGG + Intergenic
1065455836 10:25905822-25905844 GGTTTCAGGCATTCACTGGGGGG + Intergenic
1065784304 10:29199268-29199290 GGCTTCAAGCATCCACTGAGGGG + Intergenic
1067010275 10:42705149-42705171 GGTTTTAGGCACTCACTGGGGGG - Intergenic
1067077504 10:43196584-43196606 GGGTTCAGGCAGACACTGCATGG - Intronic
1068161437 10:53270283-53270305 AGTTTCAGGCTTCCACTGGGGGG - Intergenic
1068338187 10:55665628-55665650 GGTTTCAGGCAGCCACTGGGGGG + Intergenic
1068647071 10:59479902-59479924 GGATTCATGTATCCATTGGAGGG + Intergenic
1069415580 10:68197797-68197819 AGTTTCAGGCATTCACTGTGGGG - Intronic
1070088766 10:73262725-73262747 TGTTACAGGTATCCACTGGGGGG + Intronic
1070507106 10:77123641-77123663 GGTTTCAGGCATCCACTGGGAGG - Intronic
1071446811 10:85756075-85756097 GGTTTCAGGCTCCCACTAGGGGG - Intronic
1071521878 10:86336584-86336606 GGTTCCAGGCACCCAGAGGACGG - Intronic
1073842821 10:107517568-107517590 GGTTTCAGGCATCCACTGGGGGG + Intergenic
1073917236 10:108419795-108419817 GGTTTCAAGCATCCACTGGGGGG - Intergenic
1073996945 10:109326195-109326217 GGTTTCAGGAATCCACTATGAGG - Intergenic
1074180867 10:111061556-111061578 GCTATCAGGCATCCCATGGAAGG + Intergenic
1074330757 10:112506383-112506405 GATTTCAGACATCCACAGGGAGG + Intronic
1076758077 10:132585538-132585560 CGTTACAGGCGTCCACTGGGGGG + Intronic
1076830957 10:132994004-132994026 GGCTTGAGACATCCCCTGGAAGG - Intergenic
1079861102 11:25672213-25672235 AGCTTCAGGCATCCACTGACAGG + Intergenic
1081738286 11:45420461-45420483 GCTTTCAGTGATCCGCTGGAAGG - Intergenic
1081959822 11:47127500-47127522 CGTTTCAGCCACCCACTGGCTGG + Intronic
1081982519 11:47277155-47277177 GGTTTGAGGCATCCACTGGTGGG - Intronic
1082000013 11:47389129-47389151 GGTGACAGGCAAGCACTGGAGGG + Intergenic
1084034423 11:66499967-66499989 GGCTTCAGGCATCCACTACATGG + Intronic
1084759025 11:71256587-71256609 AGTTTCGGGCATCCACTGGGGGG - Intergenic
1085891438 11:80584667-80584689 GCTTTCTGACATCCAATGGAAGG + Intergenic
1086024168 11:82270210-82270232 GGTGTCAGGCATCTACAGCAAGG + Intergenic
1086527324 11:87743161-87743183 GGCTTCAGCCATCCACTGAGGGG + Intergenic
1087217153 11:95506483-95506505 TGTTTCAAGCATCCACTGGGGGG + Intergenic
1087762953 11:102121689-102121711 TGTTTCAAGCATCCACTGTGGGG + Intronic
1088284703 11:108175309-108175331 AATTTCAGGCACCCACTGGGGGG + Intronic
1088760380 11:112923705-112923727 GGTTTCAGGCATCCACTGAGGGG - Intergenic
1088832411 11:113548624-113548646 AGTTTCAGGCATCCACTGGGGGG + Intergenic
1090622669 11:128575119-128575141 GGTTTCAGGCCTCCACTGGAGGG - Intronic
1090688932 11:129156744-129156766 GGGTTCAGGGACCCACTTGAGGG - Intronic
1091140422 11:133229707-133229729 AGCTTCAGGCATCCTCTGGGGGG + Intronic
1091496218 12:975185-975207 GGTTTCAATCATCCACTGGGAGG + Intronic
1091700752 12:2659958-2659980 AGTTTCTGGCAGCCACTGGCTGG - Intronic
1092894410 12:12999181-12999203 CGTTTCAGGTATCCACTGGGGGG - Intronic
1093189267 12:16056694-16056716 GATTTCAGGCATCCTCCTGAAGG + Intergenic
1095546630 12:43379051-43379073 GAATTCCGGCAGCCACTGGAGGG + Intronic
1095994868 12:48072854-48072876 GGTTTCAAGCATCCACTGGTGGG + Intronic
1096386757 12:51199408-51199430 TCTTACAGGCATCCACTGGAGGG + Intronic
1098850100 12:75585983-75586005 GGTTTCAGGCATCCACTGGGGGG + Intergenic
1099352304 12:81588915-81588937 TGTTTCAGGTATCATCTGGAGGG - Intronic
1099704575 12:86135470-86135492 GGTTTCAGGCAAAGGCTGGATGG + Intronic
1099756870 12:86862746-86862768 GGTTTTAGGCATCCACTGGGAGG - Intergenic
1100877080 12:98973974-98973996 AGTTTCAGGCATCCACTGGGTGG + Intronic
1101289230 12:103350613-103350635 AGTTTCAGTCGTCCACTGGGAGG + Intronic
1101387804 12:104273254-104273276 GGTGGCAGGCTTCCACTGGCTGG - Intronic
1101472912 12:105015733-105015755 TGTTTCAGGCATCCTCTGGGGGG + Intronic
1104800087 12:131548490-131548512 GGTTTCAGGCATCCACTGGGGGG - Intergenic
1105401503 13:20100169-20100191 GGTTTCTGACATCCACTGGGGGG - Intergenic
1105851883 13:24342292-24342314 GTTTTCATGCATCAACTTGACGG - Intergenic
1106615870 13:31327077-31327099 GGTTTCAAACATCCACTGGGGGG - Intronic
1106664097 13:31833616-31833638 GGTTTGAGAAATTCACTGGAAGG - Intergenic
1107365885 13:39674875-39674897 AGTTTCAGGCATCCACTGGAGGG + Intronic
1108256396 13:48615707-48615729 GGATTCAGTGATTCACTGGAAGG + Intergenic
1108465393 13:50709904-50709926 GGTTTCAGGCATCCACTGGGAGG - Intronic
1112073466 13:95881234-95881256 GGTTTCAGGTATCCACTGAGTGG + Intronic
1112811531 13:103224265-103224287 GGTTTCAGTCACCCAGTGGGGGG - Intergenic
1113029513 13:105977729-105977751 GGTTTCAAGCCTCCACTCAAAGG - Intergenic
1113716693 13:112514273-112514295 GGTTTCAGGCATCCATGGGGTGG + Intronic
1115801827 14:37003059-37003081 GGTTTCAGGCATCCGCTGGGGGG - Intronic
1118270687 14:64339394-64339416 GGTTTCAGGCAGCCACAAGTAGG - Intergenic
1118380164 14:65211641-65211663 GGTTTCAGGTATCCACTGGGGGG + Intergenic
1118411019 14:65478249-65478271 GGTTTCAGGTATCCACTGGGGGG - Intronic
1118447552 14:65865657-65865679 GATATCAGGAATCCACCGGAAGG + Intergenic
1118795266 14:69137970-69137992 AGTTGCAGGCATCCACTGCGGGG + Intronic
1120070287 14:80095122-80095144 ATTTTCAGGCATTCACTGGGGGG + Intergenic
1120716653 14:87847840-87847862 TGTTTCAAACATCCAGTGGAGGG - Intronic
1121722705 14:96121893-96121915 AGTTTCAAGCATCCACTGGGAGG - Intergenic
1123783937 15:23650044-23650066 AGTTTCAGGCCTCCACAGGGGGG + Intergenic
1124570572 15:30859474-30859496 TGTTTCAGGCGGCCACTAGAGGG - Intergenic
1125213663 15:37244342-37244364 GGTTTCAGGCATCCGCTGGGGGG + Intergenic
1125361404 15:38868104-38868126 AGTTTCAGGCATTCACTGGGGGG + Intergenic
1125877301 15:43161115-43161137 GTTTTCAGGCATCCACTGGGGGG + Intronic
1126028176 15:44469181-44469203 GGTTTCAGACAACCACTGGAGGG + Intronic
1126152963 15:45539665-45539687 GGTGTCAGGCACCCACAGAATGG - Intergenic
1126486743 15:49189426-49189448 GGTTTCAGGCATCTACTGAGGGG - Intronic
1127201596 15:56659618-56659640 AGTTTCAGGCGTTCACTGGGGGG + Intronic
1127320809 15:57844104-57844126 GGCTTTGGGCATCCACTGGGGGG - Intergenic
1127542769 15:59958708-59958730 AGTTTCAGGCATTCACTGGGGGG + Intergenic
1128604261 15:69024751-69024773 AGTTTCAGGCATCCACTAAGGGG + Intronic
1129469048 15:75740126-75740148 GGCTCCAGGCATCCCCTGCAAGG + Intergenic
1129786091 15:78311129-78311151 GGTTCCTGGCAGCCTCTGGAGGG - Intergenic
1130153406 15:81329660-81329682 GGGTTCAGGCCTTCCCTGGAAGG + Intergenic
1130524008 15:84687760-84687782 GGTTCCATGCTGCCACTGGAAGG + Exonic
1130658507 15:85810845-85810867 CGTTTCAGGCATTCACTGGGGGG + Intergenic
1130767302 15:86883940-86883962 AGTTTCAGGCATCCACTGGGGGG - Intronic
1131409062 15:92190648-92190670 AGTTTCTGGCATCCACTGGGGGG - Intergenic
1131602290 15:93861933-93861955 GGTTTCTGGCAACCACTGCAGGG + Intergenic
1132223795 15:100125242-100125264 GGTTTAAGGCCTCCTCTGAAAGG + Intronic
1134103974 16:11472080-11472102 GGTTACTGGCATCTAGTGGATGG - Intronic
1134326805 16:13215023-13215045 AGTTGCAGACACCCACTGGAAGG + Intronic
1134387816 16:13790386-13790408 GGTTTCCGGCACCCACTGGGGGG - Intergenic
1134809942 16:17158731-17158753 GGTTTCATGCAGCCACAGAAAGG - Intronic
1136176202 16:28518652-28518674 GGTTTCAGGCATCCACTGCGGGG + Intergenic
1137983815 16:53091219-53091241 GCTGTCAGCCAACCACTGGATGG - Intronic
1138796315 16:59973872-59973894 GGCTTCAGGCATCCCCTGGGGGG - Intergenic
1139761823 16:69190211-69190233 GTTTTCAGACATCTAATGGAAGG - Intronic
1139808779 16:69594062-69594084 AGTTTTGGGCATCCACTAGAGGG - Intronic
1141866816 16:86755946-86755968 GATTACAGGCATGCACTGGTGGG - Intergenic
1141878825 16:86844795-86844817 GGTTTCATCCATGCCCTGGAGGG - Intergenic
1143237125 17:5412482-5412504 AGTTTCAGGCATTCACTGGGGGG + Intronic
1143320322 17:6064340-6064362 GGGATCAGCCATCCACTGGAAGG - Intronic
1143573132 17:7773499-7773521 GGTGTCAGGCATCTACTGGGGGG - Intronic
1145066957 17:19767958-19767980 GGTTTCAGACATCCACTGGGGGG + Intergenic
1146788713 17:35739403-35739425 GGTTTCAGGCAGCCAGTGTGTGG - Intronic
1149455749 17:56786647-56786669 GGTTTCAGACATCCACTGGGGGG - Intergenic
1149710783 17:58740210-58740232 GGTTTCAGGTATCCACTGGGGGG - Intergenic
1149881414 17:60295866-60295888 GGTTTCAGACATCCACTGGGAGG + Intronic
1150171720 17:63003376-63003398 CATTTCAGGCATCCACTGTGGGG - Intergenic
1151152627 17:72100937-72100959 CGTTTCAGGCAGCGATTGGAAGG + Intergenic
1152423377 17:80205696-80205718 GGTTTCAGGAATGCAGAGGAGGG + Intronic
1154285197 18:13048743-13048765 GGTTTCAGGTATCCACTTGGAGG + Intronic
1154299596 18:13181537-13181559 GGTTTCAGCCACCCACTGTGGGG - Intergenic
1154953306 18:21230757-21230779 TGTTTTAGGCATCCACTGGGGGG + Intergenic
1155124965 18:22864953-22864975 AATTTCAAGCATCTACTGGAGGG - Intronic
1155629986 18:27882014-27882036 GGTTTTCGGCATCCACTGGAGGG + Intergenic
1156312149 18:35934584-35934606 GGTTTCAGGTATCCACTGGGGGG + Intergenic
1157860387 18:51135899-51135921 GGTTTCAAGCATCCACTAGGGGG + Intergenic
1157966994 18:52219435-52219457 AGTTCCAAGCATCCACTGGGGGG + Intergenic
1158801714 18:60918955-60918977 GGATTCAGGCATCTACTAGGGGG + Intergenic
1159464429 18:68762887-68762909 GGTTTTAGGCATCCACTGGAGGG + Intronic
1160063191 18:75550627-75550649 GGTTACAGGCTTGAACTGGAGGG + Intergenic
1166910422 19:46150999-46151021 GGTTTTAGAGATCCACTGCAGGG - Intronic
1168683016 19:58329812-58329834 GGTTTCAGGCATCCACTGGAGGG + Intronic
925085611 2:1105308-1105330 GGTTTCAGGCATCTGCTGCAGGG + Intronic
925171387 2:1752132-1752154 GGTTTCAGGGTTACAGTGGAGGG + Intergenic
928058047 2:28078566-28078588 GATTTTAGGCATCCACTGGCAGG + Intronic
929835486 2:45393108-45393130 GGTTTTTGTCATCCATTGGAGGG - Exonic
930405985 2:50956333-50956355 AATTTCAAGCATCCACTGGGGGG + Intronic
930612560 2:53559458-53559480 TGTTTCAGGCATCTACTGTGGGG - Intronic
931288651 2:60853646-60853668 GGTTTAAGGTAGTCACTGGAAGG - Intergenic
932299377 2:70655295-70655317 GGTTTCAGGCACCCATGGGGGGG + Intronic
932684772 2:73858920-73858942 GATTTCAGGCATCCATTGGGGGG - Intronic
932855032 2:75224744-75224766 AGTTTCAGGCAACCAGTGGCTGG + Intergenic
933670604 2:85003946-85003968 AGGTTCAGGCATCCACTGGGTGG - Intronic
933844912 2:86317445-86317467 GGTTTTAGGGATCCCCTGAAAGG - Intronic
934118457 2:88817448-88817470 GGATTCAGGCATCCCCTGGGGGG + Intergenic
936277922 2:111116937-111116959 TGGTTCTGGCAGCCACTGGAAGG - Intronic
936471443 2:112802194-112802216 AGTTTCAGGCATTCACTGAGGGG - Intergenic
937110295 2:119361732-119361754 GGGTTCAGGCCTCCATTGGGGGG + Intronic
937123213 2:119455131-119455153 GTTTTCAGGCCTCTACTGAATGG + Intronic
938107365 2:128542325-128542347 AGTTTCAGGCATCCACTGGGGGG + Intergenic
938616267 2:133002235-133002257 GGTTTTAGGCATTCACTGGGGGG - Intronic
938700761 2:133877188-133877210 GGTTTCTGCCATCCAGAGGACGG - Intergenic
939243414 2:139592243-139592265 GGTTTTAGGCATCCACTGGGGGG + Intergenic
940755005 2:157671903-157671925 GGTTTCAGGCATCCACTGGAGGG - Intergenic
942408134 2:175677135-175677157 GGTTTCAGGCATCCACTGGAGGG - Intergenic
944045655 2:195408509-195408531 GGTTTCAGGAAAACACTGGGAGG - Intergenic
945528359 2:210918614-210918636 GGTTTCAGGCACCCAATGGGGGG - Intergenic
945665432 2:212735411-212735433 AGTTTCAGGCATTCACTGGGGGG - Intergenic
945724252 2:213455809-213455831 GGTTCCAGTCTGCCACTGGAGGG + Intronic
947129085 2:226903490-226903512 GGTTTCAGCCATCCAGTTGGGGG + Intronic
947448580 2:230183955-230183977 GGTTTCAGGCATCCACTGGAGGG - Intronic
1169143613 20:3239079-3239101 GGGTTCAGGCACCCACCGCACGG + Intronic
1169187189 20:3628653-3628675 GGTTTCACGCATCCACTGGGAGG + Intronic
1169887708 20:10419517-10419539 AGTTTCAGGCATCCACTGGGTGG - Intronic
1170446975 20:16438510-16438532 AATTTCAGGCAACCACTGGAGGG + Intronic
1170758199 20:19223489-19223511 GGTTTCGGGCATTCACTGGGAGG - Intronic
1170908637 20:20541264-20541286 AGTTTCAGTCATCCACTGAGGGG - Intronic
1172295447 20:33807341-33807363 GTTTTCAGGCATCCACTTGCAGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173938577 20:46890545-46890567 GCTTCCAGGCAGCCACTGCAAGG - Intergenic
1174297703 20:49560881-49560903 CGTGGCAGGGATCCACTGGAGGG + Intronic
1175166917 20:57050510-57050532 GACTTTAGGCATCCACTGGGGGG + Intergenic
1175272561 20:57745022-57745044 TGAGTCAGGAATCCACTGGAAGG + Intergenic
1175547052 20:59785129-59785151 CGTTTCAGGCATCCACTCTGTGG - Intronic
1176378595 21:6100414-6100436 CACTTCAGGCAGCCACTGGAAGG - Intergenic
1178582850 21:33850681-33850703 GGTTTCAGACATCAGCTGCAGGG + Intronic
1179385533 21:40938392-40938414 GGCTTCCGGCAGCAACTGGAAGG - Intergenic
1179744880 21:43437823-43437845 CACTTCAGGCAGCCACTGGAAGG + Intergenic
1181849279 22:25738433-25738455 AGTTTCAGACATCCACTGGGAGG - Intergenic
1182218227 22:28737152-28737174 GGTTTCAGGCATCCACTGGGGGG - Intronic
1183136188 22:35890319-35890341 AGTTTCAGGCATCTACTTGGGGG - Intronic
1183433838 22:37782031-37782053 GGCTCCAGGCTTCCACTGCACGG + Intergenic
1183817989 22:40319831-40319853 GGTTTCAGGCCTCCACTGGGGGG + Intronic
1184702634 22:46186807-46186829 GGCTTCAGGTATCCACTGTGGGG - Intronic
949183170 3:1159212-1159234 GGTTGTAGGCATCCACTGGGAGG - Intronic
950662120 3:14473032-14473054 GGGCTCAGGCCTCCACTAGAAGG + Intronic
950820631 3:15754609-15754631 GGTTTCAGGCATCTACTTGGGGG + Intronic
950936115 3:16841217-16841239 GGTTTCAGGCATCTGGTGGGGGG - Intronic
950986763 3:17379672-17379694 AGTTTTAGGCATCTACTGGGAGG - Intronic
951141095 3:19161250-19161272 GGTTTTAGGCATCCACCAGGTGG + Intronic
951233092 3:20202227-20202249 GTTTTCAGGCATCCACTAGTAGG - Intergenic
951957062 3:28269167-28269189 AGTGTCAGGCATCCACTAGGGGG + Intronic
952077140 3:29711033-29711055 GATTTCAGGCATCCACTGGGGGG - Intronic
952291785 3:32023758-32023780 AGTTTCAGGTATCCACTGAGGGG - Intronic
952783737 3:37131104-37131126 AGTTTCAGGCATCTGCTGGGGGG + Intronic
952863572 3:37835151-37835173 AGTTTCAGGCATCCACTGGTGGG + Intergenic
953450976 3:43005942-43005964 GGTTTCAGGCATCCGCTGGGGGG + Intronic
954593537 3:51804727-51804749 GGTTTCTGGCTTCCTCTGGAAGG + Intergenic
955865720 3:63381811-63381833 TGTTTCAGTAATCCACAGGAAGG - Intronic
956758416 3:72413650-72413672 AATTTCAGGCATCCACTGGGTGG + Intronic
957553348 3:81735097-81735119 AGTTTCAGGCATCCACTTGGGGG + Intronic
957796387 3:85014512-85014534 GGTTTCAGGCATCTCCTGGAGGG + Intronic
958004798 3:87797252-87797274 GGTTTCAGGCATTCACTGGGGGG + Intergenic
958030955 3:88109077-88109099 GGTTTCAAGCATCCAGTGGGAGG + Intronic
958790827 3:98649041-98649063 GGGTTTTGGCATCCATTGGATGG + Intergenic
958879916 3:99658166-99658188 GGTTTCAGGACTCCAGTGGAAGG - Intronic
959617191 3:108361677-108361699 GGTTTCAGGCATCCACTTGGGGG + Intronic
960428038 3:117533153-117533175 GGTTTTAAGCATCCACTGGGGGG - Intergenic
960887490 3:122411066-122411088 AGTTTCAGGCATCTACTGGGGGG + Exonic
962286972 3:134094348-134094370 AGTTTCAGGCATCCATAGGGAGG - Intronic
964745303 3:160006725-160006747 GGTATCAGGAAACCACTAGATGG - Intergenic
965093104 3:164186366-164186388 TGTTTCAGCCACCCAGTGGATGG + Intergenic
966535833 3:181032729-181032751 GGTTTCAGGCATCATCTTGTAGG + Intergenic
967005894 3:185382093-185382115 AGTTTCAGGTATCTACTGGGAGG - Intronic
968437933 4:604558-604580 GGTTTCAAGCATTCATTGGGGGG + Intergenic
968565106 4:1307964-1307986 CATTTCAGGCATCAACTTGATGG - Intronic
969471765 4:7393227-7393249 GGGCTCAGGCAGCCTCTGGATGG + Intronic
969489495 4:7491021-7491043 GGTTTCAGGAAGCCACAGGAAGG - Intronic
969664467 4:8549206-8549228 GGGTTCAGGCAGCCACTCTACGG - Intergenic
970226221 4:13860071-13860093 GGTTCCAGTCCTCCACTGAAGGG + Intergenic
970925553 4:21447534-21447556 TGGTTCAGGCATCCACTAGGGGG - Intronic
971400501 4:26271281-26271303 GATTTCAGGCATCCACTGGAGGG + Intronic
972496144 4:39636712-39636734 GGCTTTAGGCATCCACTGGGGGG - Intronic
972737469 4:41857563-41857585 GGGTTGATCCATCCACTGGAAGG - Intergenic
972846766 4:43000725-43000747 GGTTTCAGGCATCCACGAGGGGG + Intronic
973831986 4:54770888-54770910 AGATTCAGGCATCCACTGGGGGG + Intergenic
974429255 4:61774853-61774875 TGTTTCAGGCATCCACTGGGGGG + Intronic
974948086 4:68552761-68552783 GGTATCAGGGATTCTCTGGAGGG - Intronic
975393771 4:73852221-73852243 GGTGTCAGGGACCCACTGGATGG - Intergenic
976776144 4:88707998-88708020 GGCTGCATGCATCCACTAGAAGG - Exonic
976907404 4:90257014-90257036 AGTTTCAGGCATCCACTGCGGGG + Intronic
977165189 4:93686257-93686279 GGGTTTAGGGATTCACTGGATGG - Intronic
977534652 4:98242929-98242951 GGTTTCAGGCATCCACTGGGGGG + Intergenic
977672761 4:99715233-99715255 GGCTTCAGGCATGCACTGATCGG + Intergenic
978329689 4:107598978-107599000 GGTTTTAGGAATCCACTGTGGGG - Intronic
978563545 4:110058472-110058494 GGTTTCTGGCTTCCAGTGGAAGG + Intronic
978577045 4:110198249-110198271 GTTTTCCTGCATCCATTGGATGG + Exonic
979851128 4:125572757-125572779 TGTATCATGCATCCATTGGATGG + Intergenic
979968533 4:127106338-127106360 GGTTTCAGGTATCCCCAGGAAGG + Intergenic
980206064 4:129720927-129720949 GGTGTCAGGGACCCACTTGAGGG + Intergenic
980221948 4:129929252-129929274 GGTTTCAGGCATCCACTAGGGGG + Intergenic
980245319 4:130231506-130231528 AGTTTCAGGTATCCACTTGGAGG - Intergenic
982151219 4:152459641-152459663 GGTTTCAAGCATCCACTGGGGGG - Intronic
982478143 4:155877754-155877776 GGCTGCAGGCATACACAGGATGG - Intronic
983378110 4:166956173-166956195 GGTTTCAGGCATCTACTGGGGGG - Intronic
984745761 4:183215059-183215081 GGCTTCAGGCATCCACTGGGGGG - Intronic
985860085 5:2464124-2464146 GATTGCAGGAATCCACTAGAAGG + Intergenic
986048249 5:4061960-4061982 GGTTTCAGCCACCCAATTGATGG + Intergenic
987167906 5:15220140-15220162 GGATTCAGGCATCTCCAGGAAGG - Intergenic
987284136 5:16439034-16439056 GTTTTCAGGCATCCACCTGTGGG - Intergenic
990168433 5:53020024-53020046 TGTTTTAGGCATCTACTGGAGGG + Intronic
991132668 5:63142348-63142370 AATTTCAGCCATCCACTGGGGGG - Intergenic
991229675 5:64317688-64317710 TGCTTCAGGCATCCACTGGGGGG - Intronic
992756525 5:79911681-79911703 GGTGTCAGGGACCCACTTGATGG - Intergenic
994143495 5:96367265-96367287 GGTGTCAGGGACCCACTTGAGGG + Intergenic
994228171 5:97279155-97279177 GGTTTCAGGCATCCACTGAGGGG + Intergenic
994410515 5:99402270-99402292 GGTTTCAGGCATCCACTGGGGGG - Intergenic
994483310 5:100362999-100363021 GGTTTCAGGCATCCACTGGGGGG + Intergenic
995424395 5:112004075-112004097 AGTTTTAGGCATCCACTGGGAGG - Intergenic
996396018 5:123014875-123014897 GGTTTCAGGCAGAGACTGGCAGG - Intronic
997356806 5:133267628-133267650 GGACTCAGGTATCCACTGGCAGG - Intronic
997960239 5:138315377-138315399 AATTTTAGGCATCCACTGGGGGG + Intronic
998080100 5:139267945-139267967 TCTCTCAGGCATCCACTTGATGG - Intronic
999589893 5:153133412-153133434 GTTTTCAGTCATCCACTGTGTGG - Intergenic
999770564 5:154772493-154772515 AGTTTCAAGCATCTACTGGAGGG - Intronic
999990433 5:157045027-157045049 GGTTTCATGCATCTACTTGAGGG - Intronic
1000199875 5:158997726-158997748 GGCCACAGGGATCCACTGGAGGG - Intronic
1000883486 5:166723610-166723632 AGTTTCAAGCATCCACTGGGGGG + Intergenic
1000894489 5:166839045-166839067 GGTTGCAGGCATCCACTTTGGGG + Intergenic
1001060497 5:168484265-168484287 GGTTTCAGGCATCCACTGAGGGG + Intergenic
1002772298 6:300425-300447 GGTTTGAGGAATCCTTTGGAGGG + Intronic
1004101133 6:12612971-12612993 AGCTTCAGGCATTAACTGGAAGG + Intergenic
1004663538 6:17730578-17730600 GGTTTCAGGCATCCTCTGGGGGG + Intergenic
1005392872 6:25350937-25350959 AATTTCAGGCATTCATTGGATGG + Intronic
1006432790 6:34008076-34008098 GGACCTAGGCATCCACTGGAAGG - Intergenic
1006997285 6:38273291-38273313 GGATTCAGTCATCCACTGGGGGG - Intronic
1007602661 6:43092537-43092559 GGTTTTAGGCATCCACTGGGGGG + Intronic
1007937046 6:45741683-45741705 GGTTTCAGGAACCCACAGCAAGG - Intergenic
1009056479 6:58342183-58342205 GGGGTCAGGGATCCACTTGAGGG + Intergenic
1011046738 6:83092599-83092621 AGTTTCAGGCATCCATTAGGGGG - Intronic
1012733813 6:102913848-102913870 GATTTCAGGCACCCACTGCATGG + Intergenic
1013082073 6:106821714-106821736 GGTTTCAGGCACCAACTGCCTGG - Intergenic
1013433413 6:110076902-110076924 GGTTTACAGCATCCACTGGGGGG - Intergenic
1013489173 6:110628622-110628644 AATTTCAGGCATCCCCTGGGGGG + Intronic
1014158371 6:118137909-118137931 TGTTTCTGGCATCCCATGGAGGG - Intronic
1014291280 6:119561602-119561624 GGTTTTAGGCATCCACTGTGGGG + Intergenic
1014554303 6:122827209-122827231 GGTTTCAGGTATCCACTCGAGGG - Intergenic
1015250010 6:131117489-131117511 AGTTTCAGGCTTCCACTGGGGGG - Intergenic
1016316731 6:142797848-142797870 GGTTTCAGGCATTCAATTGGGGG + Intronic
1018617062 6:165696526-165696548 AGTTTTAGGGATCCACTGGGGGG + Intronic
1019459367 7:1148407-1148429 GGGTCCAGGCACCCACTGGGAGG - Intergenic
1019662210 7:2230971-2230993 AGTTTCAGGCATCAACTGACTGG - Intronic
1020761554 7:12273341-12273363 GGTTTCAGGCATCCACTGGAGGG + Intergenic
1021689511 7:23218307-23218329 GGTGACAGGCAGCCACTGGTGGG + Intergenic
1021827288 7:24568050-24568072 GGTTTCAGGTATTCACTGGGGGG - Intergenic
1022022503 7:26414421-26414443 GGTTTCAGGCATCCACTGGAGGG + Intergenic
1023066011 7:36378548-36378570 GGGTTCAGGGACCCACTTGAGGG + Intronic
1023244788 7:38190080-38190102 TGTTTCAGGCATCCCCTGGGGGG - Intronic
1024853995 7:53755246-53755268 GGTTTAAGGCACCCAGTGCATGG + Intergenic
1026589253 7:71681276-71681298 GATGTCAGGGAGCCACTGGAAGG + Intronic
1026777081 7:73237169-73237191 GCTTTCAGAAAACCACTGGACGG + Intergenic
1027017927 7:74790539-74790561 GCTTTCAGAAAACCACTGGACGG + Intergenic
1027070096 7:75155390-75155412 GCTTTCAGAAAACCACTGGACGG - Intergenic
1027697419 7:81429547-81429569 AGTTTCTGACAGCCACTGGATGG + Intergenic
1027772684 7:82427068-82427090 AGTTTCAGGCATCCACTGGGGGG + Intronic
1028053190 7:86209195-86209217 GGTTCCTGGCTGCCACTGGATGG + Intergenic
1028232299 7:88319981-88320003 GGTTGCTGGCAGACACTGGAAGG + Intergenic
1029653783 7:101911352-101911374 GGTTCAGGTCATCCACTGGAGGG - Intronic
1029782712 7:102750675-102750697 GGTTTCAGGAATCAAGTGGGGGG + Intronic
1030774806 7:113521145-113521167 AATTTCAGGCATCCACTGTAGGG - Intergenic
1031376306 7:121030790-121030812 AGTTTCAGGCATCCACTTGAGGG + Intronic
1031537291 7:122950881-122950903 AGTCTCAGGCATTCACTGGTAGG - Intergenic
1032224610 7:130021239-130021261 GGTTACAGGATTCCACTGGAGGG - Intronic
1032262690 7:130349803-130349825 TGTTTCAGGCATCCGCTGAGGGG + Intronic
1032563553 7:132916967-132916989 CATTTCAGGCATCCACAGGGGGG + Intronic
1032918771 7:136522242-136522264 AGTTTCAGGCATCCACTGAAGGG - Intergenic
1033022990 7:137746021-137746043 AGTTTCAGGCATCTACTGGGGGG + Intronic
1033094642 7:138419835-138419857 GCTTTCAGGCATACAGGGGATGG - Intergenic
1033214727 7:139484706-139484728 AGTTTCAGGCATTCACTGGGAGG - Intergenic
1036163711 8:6411797-6411819 GGATTCAGGCATCCACTGGGAGG + Intronic
1037164394 8:15809492-15809514 AGTTTCAGGCATCTACAGGGGGG - Intergenic
1039157442 8:34577301-34577323 GGTTTCAGTTATCCAGTCGACGG - Intergenic
1041162819 8:55062192-55062214 GGTTTCAGGCACCCACTGGGGGG + Intergenic
1041591692 8:59594120-59594142 GGTTTCAAGCATCCACTGGAGGG + Intergenic
1041954106 8:63538075-63538097 GGTTTCAGGCATCCACTTGGGGG - Intergenic
1042744330 8:72090311-72090333 AGTTTCAGGCATCCACTGGGGGG - Intronic
1043038461 8:75228811-75228833 GGTTTCAGGCGTCCGCTGGGAGG + Intergenic
1044410767 8:91880300-91880322 AGTTTCAGGCCTCCGCTGGGGGG + Intergenic
1045191090 8:99884677-99884699 AGTTTCAGTAATTCACTGGAAGG - Intronic
1045191141 8:99885379-99885401 GGTTTCAAGAATCCACTAGAGGG + Intronic
1045817376 8:106292552-106292574 GGTTTCAGGTATCCATTGGTGGG + Intronic
1046506072 8:115139375-115139397 GGTTTCAGGCCTCCCTGGGATGG - Intergenic
1046783653 8:118242616-118242638 GGTTTCAGGCCTCCACTGGGGGG + Intronic
1048359598 8:133686495-133686517 AGTTTCAGGCATCCCCTGCGGGG + Intergenic
1049140899 8:140953194-140953216 AGTTTCAGGCATCTACTGGGGGG - Intronic
1051067033 9:13116978-13117000 AGTGTCAGGCATCCACTGGCGGG - Intronic
1053658095 9:40240833-40240855 GGTTTCATGCATCCACTTGGGGG - Intronic
1054370217 9:64387108-64387130 GGTTTCATGCATCCACTTGGGGG - Intronic
1054526501 9:66135388-66135410 GGTTTCATGCATCCACTTGGGGG + Intronic
1054677847 9:67876864-67876886 GGTTTCATGCATCCACTTGGGGG - Intronic
1055085155 9:72306197-72306219 GATTTCAGGCATCTAATGGGGGG - Intergenic
1055208585 9:73762587-73762609 GGTTTCAGGCCTCCCTGGGATGG + Intergenic
1056176717 9:84043554-84043576 GGTGTCAGGGACCCACTTGAGGG + Intergenic
1056572755 9:87830275-87830297 GTTTTCAGGAATCTGCTGGAAGG - Intergenic
1056596082 9:88008796-88008818 GGTTTCAGACATCCACTGGGGGG + Intergenic
1057187976 9:93068835-93068857 AGTTTCAGGCATGCACTGAGGGG - Intronic
1057748400 9:97770750-97770772 GGTTTCAGGCATTTGCTGGAAGG - Intergenic
1057844815 9:98515158-98515180 GGATTCAGGCATCAGATGGAGGG + Intronic
1059055266 9:110972634-110972656 AGTTTCAAGTATCCACTGGGGGG - Intronic
1059723873 9:116987082-116987104 AGTGTCAGGCATCCACTGGGTGG - Intronic
1060800299 9:126540278-126540300 GGTTCCAGGCATCCACTGGGGGG - Intergenic
1187708060 X:22026857-22026879 GTTTTCATCCATCCATTGGAAGG - Intergenic
1188527534 X:31102372-31102394 GGTTTCAGGCATCTATTGGGGGG + Intronic
1188849746 X:35116988-35117010 AGTTTCAGGCATCAACTGAGGGG + Intergenic
1190058155 X:47194065-47194087 GGTTTCGGGGAGGCACTGGAGGG + Intronic
1190225679 X:48543105-48543127 AGTTTCAGGCATCCACTCGGGGG + Intronic
1193052060 X:77111935-77111957 GGTTTCAGGCCTCCCTGGGATGG + Intergenic
1193985685 X:88237987-88238009 GGTTTCAGGCTTCCCTGGGATGG - Intergenic
1194681124 X:96854484-96854506 GGTTTCAGACATCCACTGGAGGG - Intronic
1195335230 X:103847017-103847039 GGTTTCAGGCATCCACTGGGAGG + Intergenic
1195361279 X:104085600-104085622 AGTTTCAGGCGTCCATGGGATGG - Intergenic
1196991034 X:121328956-121328978 GGTTTCAGGCATCCATTGGGGGG - Intergenic
1198419971 X:136461624-136461646 GGTTTTAGGTGTCCACTGGGGGG + Intergenic
1199006744 X:142708467-142708489 TGTTTCAGGTATCCACTGGGGGG - Intergenic