ID: 1022025547

View in Genome Browser
Species Human (GRCh38)
Location 7:26444613-26444635
Sequence CCCTTGGATGTCTAGGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022025536_1022025547 -5 Left 1022025536 7:26444595-26444617 CCATCTCCTCCCCCTCTCCCCTT No data
Right 1022025547 7:26444613-26444635 CCCTTGGATGTCTAGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022025547 Original CRISPR CCCTTGGATGTCTAGGACCA GGG Intergenic
No off target data available for this crispr