ID: 1022029956

View in Genome Browser
Species Human (GRCh38)
Location 7:26483572-26483594
Sequence GGCCCCTGGAATCCTGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022029952_1022029956 1 Left 1022029952 7:26483548-26483570 CCATGTAGACTTTTCTTTTCTCA No data
Right 1022029956 7:26483572-26483594 GGCCCCTGGAATCCTGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022029956 Original CRISPR GGCCCCTGGAATCCTGGTCA TGG Intergenic
No off target data available for this crispr