ID: 1022034106

View in Genome Browser
Species Human (GRCh38)
Location 7:26517724-26517746
Sequence ACAGATAAGCTCCAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022034106_1022034112 5 Left 1022034106 7:26517724-26517746 CCCTGCAACTGGAGCTTATCTGT No data
Right 1022034112 7:26517752-26517774 CCTATTGGATCCCCAATGCCAGG No data
1022034106_1022034109 -10 Left 1022034106 7:26517724-26517746 CCCTGCAACTGGAGCTTATCTGT No data
Right 1022034109 7:26517737-26517759 GCTTATCTGTGGTTCCCTATTGG No data
1022034106_1022034115 16 Left 1022034106 7:26517724-26517746 CCCTGCAACTGGAGCTTATCTGT No data
Right 1022034115 7:26517763-26517785 CCCAATGCCAGGACCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022034106 Original CRISPR ACAGATAAGCTCCAGTTGCA GGG (reversed) Intergenic
No off target data available for this crispr