ID: 1022034328

View in Genome Browser
Species Human (GRCh38)
Location 7:26519342-26519364
Sequence GCTTTTAAGAAGAAGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022034328_1022034333 5 Left 1022034328 7:26519342-26519364 CCCTCCAACTTCTTCTTAAAAGC No data
Right 1022034333 7:26519370-26519392 CAGAGACTTTGCCTTAACTGGGG No data
1022034328_1022034341 22 Left 1022034328 7:26519342-26519364 CCCTCCAACTTCTTCTTAAAAGC No data
Right 1022034341 7:26519387-26519409 CTGGGGGAGGGCCGGGGTGCAGG No data
1022034328_1022034340 16 Left 1022034328 7:26519342-26519364 CCCTCCAACTTCTTCTTAAAAGC No data
Right 1022034340 7:26519381-26519403 CCTTAACTGGGGGAGGGCCGGGG No data
1022034328_1022034338 15 Left 1022034328 7:26519342-26519364 CCCTCCAACTTCTTCTTAAAAGC No data
Right 1022034338 7:26519380-26519402 GCCTTAACTGGGGGAGGGCCGGG No data
1022034328_1022034343 26 Left 1022034328 7:26519342-26519364 CCCTCCAACTTCTTCTTAAAAGC No data
Right 1022034343 7:26519391-26519413 GGGAGGGCCGGGGTGCAGGTGGG No data
1022034328_1022034336 10 Left 1022034328 7:26519342-26519364 CCCTCCAACTTCTTCTTAAAAGC No data
Right 1022034336 7:26519375-26519397 ACTTTGCCTTAACTGGGGGAGGG No data
1022034328_1022034332 4 Left 1022034328 7:26519342-26519364 CCCTCCAACTTCTTCTTAAAAGC No data
Right 1022034332 7:26519369-26519391 TCAGAGACTTTGCCTTAACTGGG No data
1022034328_1022034342 25 Left 1022034328 7:26519342-26519364 CCCTCCAACTTCTTCTTAAAAGC No data
Right 1022034342 7:26519390-26519412 GGGGAGGGCCGGGGTGCAGGTGG No data
1022034328_1022034334 6 Left 1022034328 7:26519342-26519364 CCCTCCAACTTCTTCTTAAAAGC No data
Right 1022034334 7:26519371-26519393 AGAGACTTTGCCTTAACTGGGGG No data
1022034328_1022034337 14 Left 1022034328 7:26519342-26519364 CCCTCCAACTTCTTCTTAAAAGC No data
Right 1022034337 7:26519379-26519401 TGCCTTAACTGGGGGAGGGCCGG No data
1022034328_1022034335 9 Left 1022034328 7:26519342-26519364 CCCTCCAACTTCTTCTTAAAAGC No data
Right 1022034335 7:26519374-26519396 GACTTTGCCTTAACTGGGGGAGG No data
1022034328_1022034331 3 Left 1022034328 7:26519342-26519364 CCCTCCAACTTCTTCTTAAAAGC No data
Right 1022034331 7:26519368-26519390 ATCAGAGACTTTGCCTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022034328 Original CRISPR GCTTTTAAGAAGAAGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr