ID: 1022038919

View in Genome Browser
Species Human (GRCh38)
Location 7:26560826-26560848
Sequence ATGATTAGGAGCAAAACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022038916_1022038919 -1 Left 1022038916 7:26560804-26560826 CCACCACTGGAGGCAATTAATAA No data
Right 1022038919 7:26560826-26560848 ATGATTAGGAGCAAAACAGCAGG No data
1022038917_1022038919 -4 Left 1022038917 7:26560807-26560829 CCACTGGAGGCAATTAATAATGA No data
Right 1022038919 7:26560826-26560848 ATGATTAGGAGCAAAACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022038919 Original CRISPR ATGATTAGGAGCAAAACAGC AGG Intergenic
No off target data available for this crispr