ID: 1022039381

View in Genome Browser
Species Human (GRCh38)
Location 7:26565684-26565706
Sequence TAGCATTATGTCCACTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022039381_1022039384 -1 Left 1022039381 7:26565684-26565706 CCTGTACAGTGGACATAATGCTA No data
Right 1022039384 7:26565706-26565728 ACCCACCTTGCAGGGCTATGAGG No data
1022039381_1022039382 -10 Left 1022039381 7:26565684-26565706 CCTGTACAGTGGACATAATGCTA No data
Right 1022039382 7:26565697-26565719 CATAATGCTACCCACCTTGCAGG No data
1022039381_1022039383 -9 Left 1022039381 7:26565684-26565706 CCTGTACAGTGGACATAATGCTA No data
Right 1022039383 7:26565698-26565720 ATAATGCTACCCACCTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022039381 Original CRISPR TAGCATTATGTCCACTGTAC AGG (reversed) Intergenic
No off target data available for this crispr