ID: 1022039383

View in Genome Browser
Species Human (GRCh38)
Location 7:26565698-26565720
Sequence ATAATGCTACCCACCTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022039381_1022039383 -9 Left 1022039381 7:26565684-26565706 CCTGTACAGTGGACATAATGCTA No data
Right 1022039383 7:26565698-26565720 ATAATGCTACCCACCTTGCAGGG No data
1022039378_1022039383 13 Left 1022039378 7:26565662-26565684 CCGGTATAGTGCATTTCCTTTGC No data
Right 1022039383 7:26565698-26565720 ATAATGCTACCCACCTTGCAGGG No data
1022039380_1022039383 -3 Left 1022039380 7:26565678-26565700 CCTTTGCCTGTACAGTGGACATA No data
Right 1022039383 7:26565698-26565720 ATAATGCTACCCACCTTGCAGGG No data
1022039377_1022039383 14 Left 1022039377 7:26565661-26565683 CCCGGTATAGTGCATTTCCTTTG No data
Right 1022039383 7:26565698-26565720 ATAATGCTACCCACCTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022039383 Original CRISPR ATAATGCTACCCACCTTGCA GGG Intergenic
No off target data available for this crispr