ID: 1022041138

View in Genome Browser
Species Human (GRCh38)
Location 7:26582457-26582479
Sequence CTGCTGCTTAATTCCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022041138_1022041139 21 Left 1022041138 7:26582457-26582479 CCAGCTTTGGAATTAAGCAGCAG No data
Right 1022041139 7:26582501-26582523 GAATGAACTCTTAAATCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022041138 Original CRISPR CTGCTGCTTAATTCCAAAGC TGG (reversed) Intergenic
No off target data available for this crispr