ID: 1022041513

View in Genome Browser
Species Human (GRCh38)
Location 7:26586291-26586313
Sequence CCTCAAGAACTGCGGGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022041503_1022041513 4 Left 1022041503 7:26586264-26586286 CCATCCAATAGCCCAGTAGTTCC No data
Right 1022041513 7:26586291-26586313 CCTCAAGAACTGCGGGTGTTAGG No data
1022041506_1022041513 -8 Left 1022041506 7:26586276-26586298 CCAGTAGTTCCTGCCCCTCAAGA No data
Right 1022041513 7:26586291-26586313 CCTCAAGAACTGCGGGTGTTAGG No data
1022041505_1022041513 -7 Left 1022041505 7:26586275-26586297 CCCAGTAGTTCCTGCCCCTCAAG No data
Right 1022041513 7:26586291-26586313 CCTCAAGAACTGCGGGTGTTAGG No data
1022041502_1022041513 5 Left 1022041502 7:26586263-26586285 CCCATCCAATAGCCCAGTAGTTC No data
Right 1022041513 7:26586291-26586313 CCTCAAGAACTGCGGGTGTTAGG No data
1022041504_1022041513 0 Left 1022041504 7:26586268-26586290 CCAATAGCCCAGTAGTTCCTGCC No data
Right 1022041513 7:26586291-26586313 CCTCAAGAACTGCGGGTGTTAGG No data
1022041501_1022041513 6 Left 1022041501 7:26586262-26586284 CCCCATCCAATAGCCCAGTAGTT No data
Right 1022041513 7:26586291-26586313 CCTCAAGAACTGCGGGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022041513 Original CRISPR CCTCAAGAACTGCGGGTGTT AGG Intergenic
No off target data available for this crispr