ID: 1022043407

View in Genome Browser
Species Human (GRCh38)
Location 7:26602428-26602450
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022043407 Original CRISPR CAGTGCCAGGCATAGGATGG GGG Intergenic
No off target data available for this crispr