ID: 1022045542

View in Genome Browser
Species Human (GRCh38)
Location 7:26619684-26619706
Sequence GACTCTGAAGTGTTTATGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022045542_1022045545 -2 Left 1022045542 7:26619684-26619706 CCCGCCATAAACACTTCAGAGTC No data
Right 1022045545 7:26619705-26619727 TCAGAGCCACCAATAGTATTAGG No data
1022045542_1022045549 8 Left 1022045542 7:26619684-26619706 CCCGCCATAAACACTTCAGAGTC No data
Right 1022045549 7:26619715-26619737 CAATAGTATTAGGTGTGGAAAGG No data
1022045542_1022045546 3 Left 1022045542 7:26619684-26619706 CCCGCCATAAACACTTCAGAGTC No data
Right 1022045546 7:26619710-26619732 GCCACCAATAGTATTAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022045542 Original CRISPR GACTCTGAAGTGTTTATGGC GGG (reversed) Intergenic