ID: 1022045544

View in Genome Browser
Species Human (GRCh38)
Location 7:26619688-26619710
Sequence CTCTGACTCTGAAGTGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022045544_1022045545 -6 Left 1022045544 7:26619688-26619710 CCATAAACACTTCAGAGTCAGAG No data
Right 1022045545 7:26619705-26619727 TCAGAGCCACCAATAGTATTAGG No data
1022045544_1022045546 -1 Left 1022045544 7:26619688-26619710 CCATAAACACTTCAGAGTCAGAG No data
Right 1022045546 7:26619710-26619732 GCCACCAATAGTATTAGGTGTGG No data
1022045544_1022045549 4 Left 1022045544 7:26619688-26619710 CCATAAACACTTCAGAGTCAGAG No data
Right 1022045549 7:26619715-26619737 CAATAGTATTAGGTGTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022045544 Original CRISPR CTCTGACTCTGAAGTGTTTA TGG (reversed) Intergenic
No off target data available for this crispr