ID: 1022045545

View in Genome Browser
Species Human (GRCh38)
Location 7:26619705-26619727
Sequence TCAGAGCCACCAATAGTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022045542_1022045545 -2 Left 1022045542 7:26619684-26619706 CCCGCCATAAACACTTCAGAGTC No data
Right 1022045545 7:26619705-26619727 TCAGAGCCACCAATAGTATTAGG No data
1022045543_1022045545 -3 Left 1022045543 7:26619685-26619707 CCGCCATAAACACTTCAGAGTCA No data
Right 1022045545 7:26619705-26619727 TCAGAGCCACCAATAGTATTAGG No data
1022045544_1022045545 -6 Left 1022045544 7:26619688-26619710 CCATAAACACTTCAGAGTCAGAG No data
Right 1022045545 7:26619705-26619727 TCAGAGCCACCAATAGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022045545 Original CRISPR TCAGAGCCACCAATAGTATT AGG Intergenic
No off target data available for this crispr