ID: 1022045549

View in Genome Browser
Species Human (GRCh38)
Location 7:26619715-26619737
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022045542_1022045549 8 Left 1022045542 7:26619684-26619706 CCCGCCATAAACACTTCAGAGTC No data
Right 1022045549 7:26619715-26619737 CAATAGTATTAGGTGTGGAAAGG No data
1022045544_1022045549 4 Left 1022045544 7:26619688-26619710 CCATAAACACTTCAGAGTCAGAG No data
Right 1022045549 7:26619715-26619737 CAATAGTATTAGGTGTGGAAAGG No data
1022045543_1022045549 7 Left 1022045543 7:26619685-26619707 CCGCCATAAACACTTCAGAGTCA No data
Right 1022045549 7:26619715-26619737 CAATAGTATTAGGTGTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022045549 Original CRISPR CAATAGTATTAGGTGTGGAA AGG Intergenic