ID: 1022047827

View in Genome Browser
Species Human (GRCh38)
Location 7:26637212-26637234
Sequence TTTGTGCATTCTCATGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022047827_1022047831 -6 Left 1022047827 7:26637212-26637234 CCCCACTCATGAGAATGCACAAA No data
Right 1022047831 7:26637229-26637251 CACAAACAAACCCAAACTGAGGG No data
1022047827_1022047834 8 Left 1022047827 7:26637212-26637234 CCCCACTCATGAGAATGCACAAA No data
Right 1022047834 7:26637243-26637265 AACTGAGGGATATTCTCCTGTGG No data
1022047827_1022047830 -7 Left 1022047827 7:26637212-26637234 CCCCACTCATGAGAATGCACAAA No data
Right 1022047830 7:26637228-26637250 GCACAAACAAACCCAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022047827 Original CRISPR TTTGTGCATTCTCATGAGTG GGG (reversed) Intergenic
No off target data available for this crispr