ID: 1022060650

View in Genome Browser
Species Human (GRCh38)
Location 7:26790674-26790696
Sequence CTAAGTTTTTTAAAGTATCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022060650 Original CRISPR CTAAGTTTTTTAAAGTATCC GGG Intronic
903314542 1:22491476-22491498 CTAGTTTTTTTAAAACATCCTGG - Exonic
904117433 1:28173125-28173147 AAAAGTTTTTTAAATTAGCCAGG + Intronic
904838657 1:33356011-33356033 TTTAGGTTCTTAAAGTATCCAGG + Intronic
904844444 1:33398552-33398574 CTATGTATCTTAAAGTATCTGGG + Intronic
905532422 1:38692528-38692550 CTCAGTGTTTTAAAGCATACAGG - Intergenic
905563258 1:38943621-38943643 CAAATTTTTTTTAATTATCCGGG + Intergenic
905628067 1:39501622-39501644 AAAAGTTTTTTAAATTAGCCAGG - Intronic
909779002 1:79519314-79519336 CAAAGATTTTTATAGTTTCCAGG + Intergenic
910923316 1:92372746-92372768 AAAATTTTTTTAAAGTAGCCGGG + Intronic
914005146 1:143726230-143726252 CTAATTTTTTTAAAGTTGGCTGG - Intergenic
914785073 1:150822105-150822127 CTAATTTTTTCAATATATCCAGG + Intronic
916700171 1:167284583-167284605 CTATATTTTTTAAAGTTTCTTGG - Intronic
917240944 1:172948134-172948156 CTATGTTTTTAATAGGATCCTGG - Intergenic
917695013 1:177513368-177513390 CTAAATTCCTTAAAATATCCTGG + Intergenic
918952680 1:191160273-191160295 AAAATTTTTTTAAATTATCCAGG + Intergenic
919597805 1:199586070-199586092 CTAAATTTTACAAAGTATTCTGG - Intergenic
921082457 1:211753600-211753622 ATAAGTTTTTTAAATTATAATGG + Intronic
923483928 1:234411267-234411289 CTAAGATTATTAAAGTATATGGG + Intronic
924502189 1:244648119-244648141 CGAAGTTTTTAAAACTTTCCAGG + Intergenic
924731341 1:246714252-246714274 GTAAGTTTTTTAAAGGAGCAAGG - Intergenic
1065737787 10:28770269-28770291 CAAAATTTTTTAAATTAGCCAGG - Intergenic
1068210963 10:53919875-53919897 CTAAGTTTTTATAAATACCCAGG + Intronic
1072174637 10:92907005-92907027 CTAAATTTTAGAAAGGATCCAGG + Intronic
1073684138 10:105734147-105734169 CCAAGTTATGTAAAGTATGCAGG + Intergenic
1074325051 10:112442391-112442413 CAAAGTTATTTAAAGTAGACAGG - Intronic
1076196095 10:128519396-128519418 CTAAGTTTCTTAGAGTAGGCAGG - Intergenic
1078879607 11:15435215-15435237 TTAACTTTTTTAAAGTATAATGG - Intergenic
1079493199 11:21012203-21012225 CTCTGTTTTTTACAGCATCCTGG + Intronic
1079567066 11:21895973-21895995 ATAAGATTTTTTCAGTATCCAGG - Intergenic
1080414783 11:32059146-32059168 CTGACTTTTTTGAAGCATCCAGG - Intronic
1081835611 11:46150986-46151008 CAAAGTTTTTCAAACTACCCAGG - Intergenic
1085575984 11:77603634-77603656 CTCAGTTTTTTATAGTATACTGG + Exonic
1085670605 11:78460992-78461014 ATAAATTATTTAAAGTATACAGG + Intronic
1085925242 11:81010735-81010757 CAAAGTTTTTTAAAGAATGATGG + Intergenic
1086346968 11:85906722-85906744 AAAATTTTTTTAAAGTAGCCAGG + Intronic
1090602892 11:128390977-128390999 CTTATTTGTTTAAAGTATACCGG + Intergenic
1091870705 12:3888606-3888628 CTAAGTTTTCTCATTTATCCTGG + Intergenic
1093015000 12:14146764-14146786 CAAAATTTTTAAAATTATCCAGG + Intergenic
1093291671 12:17332485-17332507 CTAAGTGTTTTAATATAGCCAGG - Intergenic
1093814177 12:23523573-23523595 ATAAATTTTTTAAAGTAACCAGG - Intergenic
1095194968 12:39303508-39303530 CTAAGTTAATTAAATTAACCTGG + Intronic
1095240680 12:39855221-39855243 CTTTATTTTTTAAAGTATTCTGG + Intronic
1095459242 12:42424815-42424837 TTCATTTTTTTATAGTATCCAGG - Intronic
1097367660 12:58736372-58736394 CTAAATTTTTTTACTTATCCAGG - Intronic
1098113997 12:67155376-67155398 AAAATTTTTTTCAAGTATCCGGG - Intergenic
1102262043 12:111448884-111448906 CTAATTTCTTTAAAGGATTCAGG + Exonic
1103266974 12:119638870-119638892 CTATTTTTTTTTAAGTATACAGG + Intronic
1104244094 12:127020634-127020656 CTCTGTTCTTTAAAGTATCAAGG - Intergenic
1106565146 13:30878226-30878248 CTAAGCTTTATAAAGAATGCGGG - Intergenic
1107470226 13:40684809-40684831 CTAATTTTTTTAAAACTTCCTGG + Intergenic
1107737000 13:43409596-43409618 CTAAGTTCTTTAAAGAAACTTGG + Intronic
1109948698 13:69472609-69472631 CTAATTTTTTTAAAGATTCTAGG - Intergenic
1110100833 13:71598962-71598984 CTAACTTTTTTAAAGTGTCTAGG + Intronic
1111550475 13:89803865-89803887 CAAAGTTTTTTCAAGTATGGAGG - Intergenic
1111824006 13:93245792-93245814 GTAAACTTTTTAAAGTATGCGGG - Intronic
1112116263 13:96358509-96358531 TTAATTTTTTTAAAGAACCCAGG - Intronic
1115387103 14:32810521-32810543 CTATGTTTTTTAACGTGTCTAGG + Intronic
1117672450 14:58122741-58122763 CAATCTTTTTTAAAGTGTCCTGG - Intronic
1120110595 14:80550475-80550497 CTGAGTTATTTAAAGTTTACTGG - Intronic
1121062003 14:90920542-90920564 TTAAATTTTTTAAATTATCAAGG - Intronic
1121367166 14:93324276-93324298 ATAATTTTTTTAAAGTAGCCAGG + Intronic
1124500200 15:30221496-30221518 CTAAGGTCTTTGAATTATCCTGG + Intergenic
1124743375 15:32317170-32317192 CTAAGGTCTTTGAATTATCCTGG - Intergenic
1126318344 15:47395038-47395060 CTCAGTTTTTAAAACTGTCCAGG - Intronic
1127417738 15:58773304-58773326 CTAAGTGTTTAGAAGAATCCAGG - Intronic
1127526983 15:59803129-59803151 CTAATTCTTTTAAACTATCAGGG + Intergenic
1128921340 15:71612785-71612807 CTAAGCTTTTTGGAGTACCCTGG - Intronic
1130813921 15:87410801-87410823 TGAAGTTGTTTATAGTATCCAGG + Intergenic
1131717893 15:95133301-95133323 ACAAGTTTTTTAAATTCTCCTGG - Intergenic
1131757115 15:95576991-95577013 CTAGGTTATTTAAAATATCAAGG - Intergenic
1133326551 16:4945560-4945582 AAAAGTTTTTTAAATTAGCCAGG - Intronic
1133885976 16:9828030-9828052 CCAAGTTTATTACAGTAGCCAGG + Intronic
1133927766 16:10207104-10207126 CTAAGTTTTTTAAATTATCATGG + Intergenic
1137438598 16:48479139-48479161 CTAAGTTTTTTACTGAATGCTGG + Intergenic
1137829924 16:51534727-51534749 ACAAGTTGTTTAAATTATCCTGG - Intergenic
1138235558 16:55379643-55379665 ATAAGTTTTTTAAGGTCTCTTGG - Intergenic
1139766610 16:69235804-69235826 CTAAGTTTCTTCAAATATCCTGG + Intronic
1140086572 16:71802425-71802447 CAAAATTTTTTAAAGTAGCTGGG - Intronic
1141232561 16:82183128-82183150 CTAAGTTCTGGAAAGTGTCCTGG - Intergenic
1146282359 17:31552891-31552913 CTATGTTTTAAAAAATATCCTGG - Intergenic
1149222582 17:54432697-54432719 GTAAGTTTTGTATGGTATCCTGG + Intergenic
1149233117 17:54559054-54559076 TCAACTTTTTTAAAGCATCCTGG + Intergenic
1149751063 17:59145826-59145848 AAAAGTTTTTTAAACTAGCCAGG + Intronic
1149917866 17:60628173-60628195 TTAATTTTTTTAAATTATGCAGG - Intronic
1150676997 17:67252814-67252836 CTAAGAGTTTTTAAGTATACAGG - Intergenic
1156996348 18:43472432-43472454 CTTAGTTTATAAAAGTTTCCTGG + Intergenic
1157685320 18:49638698-49638720 CTATGTTTTTAAAAGTCCCCAGG + Intergenic
1158273269 18:55739444-55739466 ATATATTTTTTAAAGTCTCCAGG + Intergenic
1158387389 18:57011060-57011082 ATAAGTTTTTTATGGTATCGAGG - Intronic
1159175137 18:64823486-64823508 ATAAGTTTTTAAAAATAACCGGG + Intergenic
1163923050 19:20311425-20311447 ATAAGTTTTTTGAAATTTCCTGG + Intergenic
1163973368 19:20822287-20822309 ATAAGTTTTTTGAAATTTCCTGG + Intronic
1164001437 19:21103733-21103755 AAAAATTTTTTAAAATATCCAGG + Intronic
1164490737 19:28711720-28711742 ATCAATTTTTTAAAGTATCCCGG - Intergenic
928288272 2:30012530-30012552 TTAGTTTTTTTAAAGTATCAAGG + Intergenic
929392032 2:41480652-41480674 TTAAGTTATTTAATGTATCTTGG + Intergenic
930319945 2:49842120-49842142 CTACTGTTTTTAGAGTATCCAGG - Intergenic
930364726 2:50424700-50424722 CTAAGCTTTGTAAAGAATTCAGG + Intronic
931661930 2:64573294-64573316 GTAAGTTCTTAAAACTATCCAGG + Intronic
932541898 2:72664148-72664170 ATAATTTTTTTAAATTAGCCAGG + Intronic
932572710 2:72946279-72946301 CCAAGTTTTTTAAAGAAACGTGG - Intronic
932770333 2:74497595-74497617 AAAAGTTTTTTAAATTAGCCTGG + Exonic
932834403 2:75022231-75022253 CTAAGTATTTTATAGTTTCATGG - Intergenic
933101258 2:78261252-78261274 CTAAGATTTTGAATGTGTCCTGG + Intergenic
933357960 2:81237901-81237923 TTAAGTTTCTTATAGTATTCAGG + Intergenic
935528019 2:104196701-104196723 CTAAGATTTCTAAAATATCTGGG - Intergenic
940207871 2:151224061-151224083 CTAATTTTTTTAAATCATTCAGG - Intergenic
940403859 2:153278227-153278249 TTAAGTTTCTTAAAGTTTCAGGG + Intergenic
940835069 2:158511972-158511994 CTCAGTTTTTTAAAGTGTTATGG + Intronic
941800928 2:169658958-169658980 AAAAATTTTTTAAAGTAGCCAGG + Intronic
943700423 2:190983268-190983290 TTATGTTTTTTAAAGTCACCAGG - Intronic
944463556 2:199977665-199977687 TTAAGTTTTTTAAATTACCCGGG - Intronic
944720457 2:202418200-202418222 CTAATCTTTCTAAAGCATCCAGG + Intronic
945953119 2:216059002-216059024 ATTAAATTTTTAAAGTATCCTGG + Intronic
946798955 2:223389178-223389200 CTAAGTTTTTAAAGGTTTTCTGG - Intergenic
947036238 2:225860197-225860219 CTAATTTTTTTAAGTTAGCCTGG - Intergenic
948958164 2:241310951-241310973 AAAAGTTTTTAAAATTATCCAGG + Intronic
1169628107 20:7595683-7595705 CTATGTTTCTTAAAGGATACAGG + Intergenic
1172470687 20:35192406-35192428 CTAAGTGTTTTTAAGGATTCAGG + Intergenic
1177456255 21:21343776-21343798 ATAAGTTTTTTCAAGTTTACTGG - Intronic
1180741678 22:18057435-18057457 AAAATTTTTTTAAAGTAACCAGG - Intergenic
1181993139 22:26853172-26853194 CTAAGTGTTTGACAGTATACAGG - Intergenic
1182283064 22:29228753-29228775 AAAAGTTTTTTAAACTAGCCAGG - Intronic
1183208969 22:36438465-36438487 AAAATTTTTTTAAATTATCCAGG - Intergenic
949821456 3:8120544-8120566 CCAAGTTTTTTAAACAATCTGGG + Intergenic
951779033 3:26341842-26341864 CCAAGTTTATTAAAGAATCTAGG - Intergenic
951861290 3:27256162-27256184 ATAAGTTTTTTCAATTATCTAGG - Intronic
952333128 3:32382988-32383010 CTAAGTCTTCTAAAGTGTGCAGG - Intergenic
953486776 3:43306402-43306424 ATAAGTGTTTTATAGTATACTGG + Intronic
956019861 3:64922754-64922776 CTAAGTTTTTAAAAATATTTAGG - Intergenic
957413991 3:79877465-79877487 TTAAGTGTTTCAAAGTATCTGGG + Intergenic
957429766 3:80088039-80088061 CTTAATTTTTTAAAGTCTCCTGG + Intergenic
958423658 3:93956709-93956731 CCAAGTTTTTTAAAGCATTTTGG + Intronic
959800849 3:110494151-110494173 CTAAGTTTCTTACAGCATCTGGG + Intergenic
960127090 3:114011725-114011747 CTAACATTTATAAAGTTTCCAGG - Intronic
960330779 3:116357966-116357988 CCAAGTTTCCTAAAGTTTCCTGG - Intronic
960579190 3:119259849-119259871 CTGACATTTTTAAAGTATACAGG + Intergenic
961084835 3:124057859-124057881 CTCATTTTCTTAATGTATCCAGG - Intergenic
963500094 3:146114956-146114978 CCAAGTTTTCTACAGAATCCTGG - Intronic
963961971 3:151319513-151319535 CAAAATTTTTTAAAGTTTTCTGG - Intronic
964115259 3:153130172-153130194 TTAAGTTTATTAAAGTGTCTTGG + Intergenic
964524831 3:157607226-157607248 CTATGTTTTTTAAAGGTTCTTGG - Intronic
964729620 3:159851112-159851134 AAAAATTTTTTAAATTATCCAGG + Intronic
965424307 3:168502389-168502411 TTAAGTTCTTTAAATTATCTTGG + Intergenic
965770074 3:172172649-172172671 GTAAGGTTTTTAAAGAATCTGGG - Intronic
966314343 3:178628787-178628809 CTAAGTCTTTTAAAGAATTCTGG + Intronic
966362217 3:179142544-179142566 CTAAGATTTTAAAAATATCTGGG + Intergenic
966405515 3:179593323-179593345 CTATTTTTTTTAAAGTCTCAGGG - Intronic
967041866 3:185701333-185701355 TTATTTTTTTTAAAGTATACTGG + Intronic
970160751 4:13186478-13186500 CTAACTTTTAAAAAGTATGCCGG - Intergenic
972309474 4:37866542-37866564 CCGAGTTTTTTAAAGTCTCTAGG + Intergenic
975916741 4:79334078-79334100 AGAATTTTCTTAAAGTATCCAGG + Intergenic
975996382 4:80321038-80321060 GTAAATTTTTTAAATTAGCCAGG - Intronic
976243181 4:82981043-82981065 CTATGAATTCTAAAGTATCCTGG + Intronic
976279228 4:83310509-83310531 AAAATTTTTTTAAAGTAGCCAGG + Intronic
979147167 4:117258467-117258489 CTAAATTTTTTAATGTAACTAGG + Intergenic
979307547 4:119164653-119164675 ATAACATTTTTAAAGTATCAAGG - Intronic
979493496 4:121357714-121357736 TTAAGCTTTTTAAAGTTCCCAGG + Intronic
979768655 4:124494100-124494122 CTAAGTCTTTTAAAATGTTCTGG - Intergenic
981295799 4:143129716-143129738 CCAAGTTTTCTACAGAATCCTGG - Intergenic
981356938 4:143799650-143799672 GTAAGTTTTTAAAAGCAGCCAGG + Intergenic
981368469 4:143930246-143930268 GTAAGTTTTTAAAAGCAGCCAGG + Intergenic
981378266 4:144040532-144040554 GTAAGTTTTTAAAAGCAGCCAGG + Intergenic
982527365 4:156496012-156496034 CTGAGGTTTTTATAGTAGCCAGG + Intergenic
982589729 4:157292441-157292463 CTAAGATTTTCAAACTATTCTGG - Intronic
984723267 4:182996670-182996692 ATAATTTTTTTAAAGTATCCAGG + Intergenic
986187303 5:5456684-5456706 ATAAGTTTTATAGAGGATCCAGG - Intronic
987485397 5:18519743-18519765 CTATGTTTTTTTAACCATCCTGG + Intergenic
987556971 5:19464971-19464993 ATTTTTTTTTTAAAGTATCCGGG - Intergenic
987641675 5:20620233-20620255 ATAACTTTTTTAAAGTAACATGG + Intergenic
988282020 5:29161715-29161737 AGAAGTTTTCTAAATTATCCAGG - Intergenic
989331494 5:40264861-40264883 CTATGTGTGTTAAAGTTTCCAGG - Intergenic
989417146 5:41192599-41192621 GTAAGTTTTTTTTTGTATCCAGG + Intronic
990520547 5:56575125-56575147 AAAATTTTTTTAAAGTAGCCAGG + Intronic
991290978 5:65033775-65033797 CGATATTTTTTAAAGTTTCCTGG + Intergenic
991384387 5:66069077-66069099 TTAAGTGTTTTAATGTTTCCAGG + Intronic
991569399 5:68038384-68038406 CTAAGTTTTCAAAAGAAACCAGG - Intergenic
993418491 5:87668179-87668201 ATAAGTTATATAAAGTACCCTGG + Intergenic
993700205 5:91110190-91110212 ATAAGTTTCTTAAACTATTCAGG + Intronic
994521911 5:100849978-100850000 CTATATTTTTTTAAGTATACAGG + Intronic
995030871 5:107479904-107479926 TTTAGTTTTTTAAAATATACTGG - Intronic
996248119 5:121291196-121291218 CTAAATTGTTTCATGTATCCGGG - Intergenic
996807637 5:127475434-127475456 TTAGGTTTTTTAAAATTTCCTGG + Intergenic
997096731 5:130921855-130921877 CTAAGATATTTAAAGTCTGCTGG - Intergenic
997148100 5:131459716-131459738 CTAATTTTTTTAATTTATCTTGG - Intronic
997555965 5:134799023-134799045 TAGAGTTTTTTAAAGTTTCCGGG + Intronic
998409069 5:141894768-141894790 CTTAGTTCTTTAAAGTATTCTGG - Intergenic
998738245 5:145167849-145167871 CTAAACTTTTTAAAGTTTCTTGG - Intergenic
1000111587 5:158113203-158113225 ATAATTTTTTTAAAGAAACCTGG - Intergenic
1000214891 5:159145869-159145891 CTAATTTTTCCAAAGAATCCAGG + Intergenic
1000518341 5:162268573-162268595 CTAAGTTTCTTCAAATATCTAGG + Intergenic
1001068547 5:168561593-168561615 CTAATTTTATAAAAATATCCAGG - Intronic
1002488983 5:179560411-179560433 CTAACGCTTTTAAAGTAACCTGG - Intronic
1004451255 6:15748951-15748973 CAAAGTTTTTAAAAATAGCCAGG + Intergenic
1004486419 6:16070306-16070328 CTAATTATTTTAAAGCATCATGG + Intergenic
1008300002 6:49825003-49825025 CAAAGTTGTTTAAAATACCCAGG - Intergenic
1011730165 6:90253893-90253915 CTATTTTTTTTAAACTATCATGG + Intronic
1011787547 6:90863957-90863979 GTATGTTTTTGAAAGTTTCCTGG - Intergenic
1013552428 6:111221114-111221136 CTAAGTTATCTAAAATGTCCAGG - Intronic
1013864417 6:114677892-114677914 CTTAGTTTTTAAAATTATTCTGG - Intergenic
1014470634 6:121810110-121810132 CTAAATTTTTCAAAGTATGCAGG - Intergenic
1016208185 6:141495974-141495996 CTAAGTTTTTTTTAGTCTACTGG + Intergenic
1016492212 6:144618593-144618615 CTCATTTTTTTAAAGTTTCTTGG - Intronic
1016752100 6:147641789-147641811 TTAAGTTATTTAAAGTTTACAGG - Intronic
1017255803 6:152331841-152331863 CTAACTTTTTCAAAGCTTCCAGG + Exonic
1017397032 6:154013255-154013277 ATTAGTTTTTGAAAGTTTCCTGG - Intronic
1019419488 7:944074-944096 AAAAGTTTTTTAAAGTAGCTGGG - Intronic
1021530245 7:21636128-21636150 CAAAGTTTTGTAAAGTAACATGG + Intronic
1022060650 7:26790674-26790696 CTAAGTTTTTTAAAGTATCCGGG + Intronic
1023535142 7:41200732-41200754 CTAATTTTTCTAAAGGATTCCGG - Intergenic
1024294690 7:47832822-47832844 ATAACCTTTTTAAAGTATTCTGG - Intronic
1024299790 7:47878077-47878099 CTAAGGTTTTGAGAGAATCCAGG - Intronic
1024345878 7:48312515-48312537 CTGACATTTTTAAAGAATCCAGG + Intronic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026269372 7:68823047-68823069 CTAAGTTTTTTAAACTTTTGTGG + Intergenic
1027370275 7:77502141-77502163 AAAATTTTTTTAAAGTAGCCAGG - Intergenic
1028156704 7:87437830-87437852 CATAATTTTTTAAAGTCTCCAGG - Intronic
1030908833 7:115221106-115221128 TCAAGTTTTTTAAACTTTCCAGG - Intergenic
1031805994 7:126306839-126306861 GTAAGTCATTTAAAGTATCTGGG - Intergenic
1032349759 7:131149923-131149945 CTAAGTTTGTTAAAAGATCAAGG + Intronic
1036807427 8:11845204-11845226 CTGAGTATTTTAAAGAAGCCTGG + Exonic
1037330779 8:17741669-17741691 CTATCTTTTTCAATGTATCCTGG + Intronic
1037619822 8:20553876-20553898 CTTTGTTTCCTAAAGTATCCAGG + Intergenic
1040908984 8:52499123-52499145 CTAAGATATTTTAAGTTTCCTGG + Intergenic
1040909111 8:52500743-52500765 CTAAGATGTTTTAAGTTTCCTGG + Intergenic
1041926428 8:63242122-63242144 CTAAGAATTTTAAATTAGCCTGG - Intergenic
1041941460 8:63392544-63392566 CTCAGTGGTTTAAAGTATTCTGG - Intergenic
1042373186 8:68016776-68016798 CAAAGATTTTTAAAGTTTGCTGG - Intronic
1042631819 8:70825765-70825787 CAAAGGATTTTTAAGTATCCAGG - Intergenic
1044655468 8:94543542-94543564 TTACGTTTTCTAAAATATCCTGG - Intronic
1045834727 8:106506732-106506754 CTAAGTATTTTGGAATATCCAGG - Intronic
1045897225 8:107234118-107234140 ATAAGAATTTTAAAGTATCATGG + Intergenic
1046296418 8:112225082-112225104 CTCAGGTTTTTAAAGTAACAAGG - Intronic
1046559674 8:115819838-115819860 AGAAATTTTTGAAAGTATCCAGG + Intergenic
1047345882 8:124028074-124028096 CTAAATATTTTGATGTATCCTGG + Intronic
1048481647 8:134801445-134801467 CAAAGATTTTTAAAGTTTGCTGG - Intergenic
1049975396 9:856883-856905 CTAAGTTTTTTTAAGTTACAAGG + Intronic
1051018384 9:12509554-12509576 CTAATTTTTATAAAGTATTTTGG + Intergenic
1052895185 9:33741070-33741092 CTGTGTTTTTTATTGTATCCAGG - Intergenic
1055015270 9:71610137-71610159 CTAAGTTTGTTGCATTATCCTGG + Intergenic
1055027815 9:71741133-71741155 CAAGATTTTTTAAAGTCTCCAGG + Intronic
1055268352 9:74525908-74525930 CTAAATTTTTTAAAGTATAGGGG + Intronic
1055525028 9:77124324-77124346 GTGAGTTTTAAAAAGTATCCTGG - Intergenic
1057408479 9:94795223-94795245 TACAGTTTTTTAAAGTCTCCAGG - Intronic
1057450625 9:95155645-95155667 CAGAGGTTTTTAAAGTCTCCTGG + Intronic
1185950565 X:4428029-4428051 CTAAGTTTTTGCTAGTGTCCTGG + Intergenic
1186636821 X:11415159-11415181 ATAAATTTTAAAAAGTATCCAGG + Intronic
1186823616 X:13315767-13315789 CTGAAATTTTTAAAATATCCAGG + Intergenic
1188974167 X:36653609-36653631 CATAGTTTTTTAAACTCTCCAGG - Intergenic
1189457806 X:41209327-41209349 CTGAAATTTTTAAAGAATCCAGG + Intronic
1190185435 X:48229532-48229554 TTAATTTTTTTTAAGAATCCAGG + Intronic
1193211069 X:78807614-78807636 CTAAGTTTTCCAAAGTATTTTGG + Intergenic
1193925871 X:87483612-87483634 GTAAGTTCTTTAAAGAATGCTGG + Intergenic
1194499351 X:94660395-94660417 CTCAGTTTTAGGAAGTATCCTGG + Intergenic
1195531893 X:105967270-105967292 CTATGGTTTTTAAAGCATCAGGG - Intergenic
1195919642 X:109970992-109971014 AAAAATTTTTTAAATTATCCAGG - Intergenic
1197205623 X:123787473-123787495 CTGATTATTGTAAAGTATCCTGG - Intergenic
1197718685 X:129729224-129729246 CTGAGTTTTTAAAAACATCCTGG - Intergenic
1198408176 X:136337423-136337445 ATAATTTTTTTAAAGAATCTTGG - Intronic
1200293710 X:154896026-154896048 CAAAATTCTTTAAAGTATTCAGG + Intronic
1200307533 X:155043094-155043116 ATAACTTTTTTAAATTAGCCAGG - Intronic
1200795509 Y:7337819-7337841 CTAAGGTTGTATAAGTATCCAGG - Intergenic
1201301898 Y:12514561-12514583 AAAAGTTTTTTAAAACATCCGGG - Intergenic
1202273454 Y:23092703-23092725 TTAATTTTTTTAAAGGAGCCAGG + Intergenic
1202292572 Y:23327979-23328001 TTAATTTTTTTAAAGGAGCCAGG - Intergenic
1202426451 Y:24726447-24726469 TTAATTTTTTTAAAGGAGCCAGG + Intergenic
1202444338 Y:24943639-24943661 TTAATTTTTTTAAAGGAGCCAGG - Intergenic