ID: 1022063651

View in Genome Browser
Species Human (GRCh38)
Location 7:26827658-26827680
Sequence TGTGATGTCTTGGGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022063651 Original CRISPR TGTGATGTCTTGGGAAAAAC TGG (reversed) Intronic
901445926 1:9308131-9308153 TGACATGTCTTGGAAAACACTGG - Intronic
903134222 1:21298751-21298773 TCTGATGTCATGGGAAAACCTGG - Intronic
904148999 1:28420788-28420810 TGTCAAGTAATGGGAAAAACTGG + Intronic
907747064 1:57223900-57223922 TGTGATATCATGGGGAAAACTGG + Intronic
907914394 1:58855344-58855366 TTTGAAATCTTGGGAAAAAGAGG - Intergenic
908406019 1:63815047-63815069 TTTGATCTCTTTGGAAAAAAGGG + Intronic
908860357 1:68479403-68479425 TGTGAAGTATTGGGAAAAAGTGG + Intronic
909224407 1:72998787-72998809 TGTGACTTCTTAGAAAAAACAGG + Intergenic
911057358 1:93720398-93720420 TGTGTGCTCTTGGGCAAAACAGG + Intronic
911191173 1:94949938-94949960 GGTGAAGTCTGGGGAAAACCAGG + Intergenic
914912218 1:151796714-151796736 TGTGATGGCTTCAGAATAACTGG + Intergenic
918202506 1:182280362-182280384 TGTGTTCTCTAGGGAAAAAAAGG - Intergenic
918223043 1:182453568-182453590 TGTGATGTCTTTATAAATACTGG + Intronic
918967066 1:191364778-191364800 TATGTAGTCTTGGGACAAACAGG - Intergenic
919210221 1:194473202-194473224 TGTAATATCTTGGGAAGAGCTGG + Intergenic
921438869 1:215160217-215160239 TGTTATTTCTTAAGAAAAACAGG - Intronic
922216641 1:223525475-223525497 AGGGATGTCTTGGGCAAAAGTGG - Intergenic
923403314 1:233636729-233636751 AGTGATGTCATAGGAAAAACAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063075207 10:2709869-2709891 TGTGATGTTTTGTGGAAAACTGG + Intergenic
1065836647 10:29664060-29664082 TGTGCTGTCATGGGATACACGGG - Intronic
1066785770 10:39002547-39002569 TGAGGTGTATGGGGAAAAACTGG - Intergenic
1067455268 10:46414626-46414648 GATGATGTCTTAGGAAGAACAGG - Intergenic
1067631935 10:47970008-47970030 GATGATGTCTTAGGAAGAACAGG + Intergenic
1070704785 10:78629755-78629777 TGTGATTTCTTGGGAAGAAGTGG - Intergenic
1072448182 10:95517549-95517571 TGTGAGGTTGTGGGGAAAACAGG - Intronic
1075953684 10:126504483-126504505 TGGGGTGTCTGGAGAAAAACTGG + Exonic
1079146090 11:17853360-17853382 TGTGGTGCCTTGGGAAATACAGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082984464 11:59156486-59156508 GGTGATATCTTGGAAAAGACTGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083597942 11:63928345-63928367 AGTGATGACTTGGGCAAAGCAGG + Intergenic
1085111249 11:73891343-73891365 TCTGATGTGTTTGGCAAAACTGG + Intronic
1085118179 11:73948989-73949011 TGTACTGGCTTGGGAAGAACTGG + Intergenic
1086461469 11:87009897-87009919 TGTGATTCATTGGGAAAATCAGG + Intergenic
1087376137 11:97343032-97343054 TGTCATCTCTTGGGAGAAAGGGG + Intergenic
1087876396 11:103363181-103363203 TCTGATGTGTTAAGAAAAACAGG - Intronic
1087960409 11:104341147-104341169 TGTAATGTCTTGGGAGCAACAGG + Intergenic
1089484462 11:118834316-118834338 TCTGATCTCTTTGGAAAAAATGG + Intergenic
1089852556 11:121513077-121513099 TAGGATGTCTTGTGACAAACTGG - Exonic
1090904545 11:131063762-131063784 TGTGAGGTCTTGAGAAGAAGGGG - Intergenic
1094040078 12:26113420-26113442 TGTAATGTCTTAGCAAATACTGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094621926 12:32088150-32088172 TGTGATTTTTTTGAAAAAACAGG - Intergenic
1095179510 12:39131256-39131278 TGAGATGTATTGGAAGAAACAGG + Intergenic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1110658391 13:78028549-78028571 TGTGATGTAGAGGGTAAAACAGG + Intergenic
1112187037 13:97137392-97137414 AGAGATGTCTTGGGAAAGTCTGG - Intergenic
1113899927 13:113791084-113791106 TGTGATGTTTTGGGTGAAATTGG + Intronic
1116401919 14:44517683-44517705 TGTGTTGAATGGGGAAAAACTGG - Intergenic
1116563515 14:46415258-46415280 TGTGAGGGCTTGGGGAAAAGAGG - Intergenic
1116944194 14:50820733-50820755 TGTGACTTCTTTGCAAAAACTGG - Intronic
1118883463 14:69848267-69848289 TGTAGTGTCCTGGGAAGAACAGG + Intergenic
1120463076 14:84821662-84821684 TGTGTTGAATTGGGAAAAAATGG + Intergenic
1121278054 14:92680979-92681001 TGTGAAGTCATGGGACAGACAGG + Intronic
1122922488 14:104885730-104885752 TTTGAGGTCCTGGGCAAAACGGG + Intronic
1127879222 15:63141511-63141533 AGAGATGTCTTGGGATAAAGAGG + Exonic
1129080424 15:73034566-73034588 TGTCATGTTTTGGGAAATATGGG - Intergenic
1130441686 15:83961026-83961048 CTTGATGTCTAGGGAAAAAGTGG + Intronic
1133119029 16:3595124-3595146 TGCGCTGTCTGGGGAAGAACCGG - Intronic
1134312330 16:13086588-13086610 TGTGGTGTCTTGGGCCAAAATGG + Intronic
1134368686 16:13603495-13603517 TGTGAGCTGTTGGGCAAAACTGG + Intergenic
1134801550 16:17089551-17089573 TGTGGTATCTTGGGAAGAACAGG - Intergenic
1137551046 16:49437774-49437796 TGTGATGTCTTGGGGAACTTGGG - Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1139282573 16:65783364-65783386 TTTGATTTCTTGGGAGAAAAAGG + Intergenic
1141990779 16:87608270-87608292 TGTGGAGGCTTGGGGAAAACAGG - Intronic
1143433114 17:6901388-6901410 TCTGATGTAATGGGAAAAAAAGG + Intronic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1146684519 17:34832364-34832386 TCTGAGGTCTTGGGATAATCAGG + Intergenic
1147034549 17:37670569-37670591 TTTGATGTCTCGGGAGAAGCAGG + Intergenic
1147679766 17:42234360-42234382 TTTGATGTCTTGGGTCAAATTGG - Intronic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1152848345 17:82616297-82616319 TGTGATTTCCTGGGGGAAACTGG + Intronic
1153488443 18:5625537-5625559 TGAGATGACTGGGGAATAACTGG + Intronic
1153692575 18:7608199-7608221 TGAGATGACTTGGGAAAAAGAGG + Intronic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155126179 18:22878413-22878435 TCTGATGTATTGGAAGAAACTGG - Intronic
1155502227 18:26498109-26498131 TGTCATCTCTTGTGTAAAACAGG - Intronic
1157314874 18:46578987-46579009 TGTGATGGCTGGGGAAACAGGGG + Intronic
1158071944 18:53481026-53481048 TGTCATGTCTTGGGGAATCCAGG - Intronic
1158660651 18:59384611-59384633 TGTGAGCTATTAGGAAAAACAGG + Intergenic
1159205287 18:65243047-65243069 AGTGATGTGTTGGAAATAACAGG + Intergenic
1165155923 19:33787559-33787581 TGTGCTGGCTTGGGAAGAGCTGG - Intergenic
1165393003 19:35549075-35549097 TATGTTCCCTTGGGAAAAACAGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167986957 19:53326811-53326833 TGTGTTGTGTTGGGACAAATGGG + Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925070467 2:963200-963222 TGTGATGCTTTTGGAAAAATAGG - Intronic
926154477 2:10445460-10445482 TGTGCTGCCTTGGAAAAACCTGG - Intronic
928672291 2:33613998-33614020 TGGGCTGCCTGGGGAAAAACAGG + Intergenic
930265412 2:49193951-49193973 TGAGATGTTTTGGGAGAACCCGG + Intergenic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933065596 2:77791225-77791247 AGGGTTGTCTTGGAAAAAACTGG + Intergenic
933581893 2:84136452-84136474 TGTGATGGCTGGAGAAAAACTGG - Intergenic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
935791032 2:106590411-106590433 TGTGATGTCCAGTCAAAAACTGG + Intergenic
940652867 2:156454793-156454815 GGTGATGTCTTGGGGGAAATTGG + Intronic
940912185 2:159218551-159218573 GGTGATGTGTTGGGGAAAAATGG + Intronic
940944678 2:159602038-159602060 TAGGATGTTTTGGGGAAAACTGG + Intronic
941379696 2:164777874-164777896 TCTTATGTCTTTTGAAAAACTGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942234573 2:173891472-173891494 TGTTATGTCTTTGGGAAAACTGG - Intergenic
942832751 2:180256022-180256044 TGTGATTTCATGGGCAATACAGG + Intergenic
943456781 2:188118304-188118326 TGGGAAGTCCTGTGAAAAACTGG - Intergenic
1168733578 20:109840-109862 AGTGATGCCTAGGAAAAAACAGG + Intergenic
1174983432 20:55422677-55422699 ATTCATGTCTTGAGAAAAACAGG + Intergenic
1175187151 20:57186507-57186529 TGTGCTGTCATGAGTAAAACAGG - Intronic
1177155028 21:17492886-17492908 TGTGGTGGCTTGGGAATCACTGG - Intergenic
1178359032 21:31932823-31932845 GGGGATGTCTTAGGAACAACAGG - Intronic
1179097719 21:38330509-38330531 TGTGATGTCTTGAGCCATACTGG + Intergenic
1183243061 22:36672690-36672712 GGTGATGCCTTGGGAAGAATGGG - Intronic
1183519982 22:38291306-38291328 CCTGCTGTCTTGGGAAACACAGG + Exonic
1184607131 22:45580635-45580657 TGTGGTGTCTGGGGAAGACCGGG - Intronic
949402378 3:3679168-3679190 TGGGATGTCCTGGGAAAATTGGG - Intergenic
949722300 3:7004302-7004324 TATGATGTATTGGGATGAACTGG + Intronic
949760514 3:7465193-7465215 AGTGATGTGTTAGGAAAAACAGG + Intronic
949787156 3:7754405-7754427 TGGGATGTGTAGGGGAAAACTGG + Intergenic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
952733249 3:36662173-36662195 TGGGATGTTTTGGGAAGAATCGG - Intergenic
953362777 3:42313293-42313315 TCTGATTACTTGGGAAAACCGGG - Intergenic
954380767 3:50217902-50217924 TATGCTGTCTGGGGAAACACGGG - Exonic
955626168 3:60921870-60921892 TGTGATGTCTTGGCATGATCAGG - Intronic
955722612 3:61899572-61899594 TGTGCTGTCTATGGAAAAAAGGG + Intronic
956515740 3:70045795-70045817 TGTGTTACCTTGGGAAAATCTGG + Intergenic
957538519 3:81537645-81537667 TGTGATGTGGTAGGAAAAACTGG - Intronic
960329657 3:116343185-116343207 TGTGATGGATTTGGAAAGACAGG + Intronic
960440952 3:117688311-117688333 TGTGATGTCTTGACATAAACAGG + Intergenic
960982907 3:123248755-123248777 TGCGTTGTATAGGGAAAAACAGG + Intronic
961109108 3:124268689-124268711 AGTGATGTCAGGGGAAGAACAGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961604724 3:128085193-128085215 TGTGAGGTATTGGCAATAACGGG - Intronic
961636453 3:128335906-128335928 TCTGATGTCAGGGGAAAAGCTGG - Intronic
963247916 3:143079922-143079944 ACTGATGTGGTGGGAAAAACGGG - Intergenic
963577954 3:147085765-147085787 AGTGATGTATTAGGAAAAACAGG + Intergenic
963863759 3:150337954-150337976 TCTGATTTTTTGGGAAAAAAAGG - Intergenic
963924637 3:150938520-150938542 TGTGACCTCTGGGGATAAACAGG - Intronic
964838101 3:160962930-160962952 AGAGATGTCCTGGGCAAAACTGG - Intronic
964861440 3:161206575-161206597 TGGAATGTCTAGGGCAAAACAGG - Intronic
964863631 3:161229814-161229836 TGTGATGTCCTGGGAGGAAAGGG + Intronic
965889519 3:173494071-173494093 TGTGAAGGAATGGGAAAAACAGG - Intronic
965898336 3:173606724-173606746 TGTTATTTCTTGGGTAATACTGG + Intronic
967496591 3:190149322-190149344 TGTGATGGCTTGGAAAAACAGGG - Intergenic
967657741 3:192071976-192071998 TGTGATGGCTTGGAAAAACAGGG + Intergenic
967740834 3:193000507-193000529 TGTGATGGCTTGGAAAAACAGGG - Intergenic
967753597 3:193142835-193142857 TTTGATGACTTATGAAAAACAGG - Intergenic
969902778 4:10364970-10364992 TGTGATGCCTTTGGGAAAAGTGG + Intergenic
971196814 4:24477839-24477861 TGTGTTCTCCTGGGAGAAACTGG - Intergenic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
972226763 4:37022188-37022210 TGTGATGTGGTTGGAAAAATGGG + Intergenic
972432682 4:38998725-38998747 TGTGATGTCTTGGCAAGTCCTGG + Exonic
973160576 4:47011223-47011245 GGTGAGGTCTTGGGCAAAACAGG - Intronic
976552788 4:86415443-86415465 TTTGATAACTTAGGAAAAACGGG + Intronic
977706942 4:100081998-100082020 TGTGATGGGTTGGGAAGAAAGGG + Intergenic
978279749 4:106996526-106996548 TTTGATGTCTTGGGGAAAGAAGG - Intronic
978693275 4:111542724-111542746 TATGATATCTTGGAATAAACTGG + Intergenic
979788021 4:124741097-124741119 AGTGATGTCATGGTAAGAACTGG - Intergenic
983394432 4:167175653-167175675 TGTGGAGGCTTGGGAAAGACAGG + Intronic
986262747 5:6162699-6162721 TGAGTTGTCTTGGGCAACACAGG + Intergenic
986294359 5:6424649-6424671 GGGGCTGTCTTGGAAAAAACTGG - Intergenic
987000477 5:13655094-13655116 TGAGAAGTCATGGGAAGAACTGG + Intergenic
989103960 5:37843509-37843531 TTTGGTGTCTTGGGAACAAGGGG + Intergenic
990203591 5:53405282-53405304 TGTGATCTCTTGAGTAAAGCTGG - Intergenic
990551151 5:56880618-56880640 TGTAATGCCTTGTGAAAAAGTGG - Intronic
995033588 5:107508121-107508143 GGTGATGCCTTGGGCAAATCAGG + Intronic
998558659 5:143150306-143150328 TGTGAACTCTTGGGGAAGACAGG - Intronic
998990868 5:147814778-147814800 TATGATGACATGGGAAAAAATGG + Intergenic
999540703 5:152569503-152569525 TGGGATGTTTTGTGGAAAACAGG + Intergenic
1000690781 5:164317631-164317653 TTTTATGTCTCTGGAAAAACAGG + Intergenic
1001723591 5:173877279-173877301 GATGATGACTTAGGAAAAACTGG + Intergenic
1003985283 6:11428887-11428909 TGAGATGTGTTTGGCAAAACCGG - Intergenic
1005301940 6:24479492-24479514 TTTCATGTCTTGGCAAAGACTGG - Intronic
1005426151 6:25704767-25704789 TTTGATGTGTTGGGAAAAAGTGG + Intergenic
1005938997 6:30546917-30546939 TGGAATGTTTTGGGGAAAACTGG - Intronic
1007977447 6:46115861-46115883 TTTTATGTCATGTGAAAAACTGG - Intergenic
1008898955 6:56589264-56589286 TGTGATGTTTTGAGAAGAAGAGG - Intronic
1009366685 6:62862117-62862139 CGTGATATCTTGGGAAAGAGAGG - Intergenic
1011747256 6:90418392-90418414 TAGGATGTCTTGGGAAAGACTGG + Intergenic
1012061920 6:94496285-94496307 TTTGATGGCTTGGGAAAAGTGGG - Intergenic
1012212504 6:96538867-96538889 TCTGATGTCTTTTGAAAAAGGGG + Intronic
1012822020 6:104097154-104097176 AGAGATATCTTGGGAAATACAGG + Intergenic
1012946588 6:105472816-105472838 TGTTATATCTTGGAAATAACAGG - Intergenic
1013818672 6:114129917-114129939 TGTGATATTTTGGGATAAAGAGG + Intronic
1014665656 6:124233745-124233767 TGTGATGTCTAGAGAAAGAATGG + Intronic
1014709645 6:124791767-124791789 TTTGTAGTCTTGGGTAAAACTGG - Intronic
1014762955 6:125377978-125378000 AGAGATGTCTTGGTGAAAACAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015990337 6:138935085-138935107 TGTGAAGTGTTGGGGAAAAGTGG - Intronic
1017635642 6:156440457-156440479 TGTGAGGTCTTGGTTAGAACTGG - Intergenic
1018196287 6:161358651-161358673 TGTGATGGTTTGGGATAAACAGG - Intronic
1018431981 6:163729890-163729912 TATGAGGTCTTGGGAGAACCCGG + Intergenic
1022063651 7:26827658-26827680 TGTGATGTCTTGGGAAAAACTGG - Intronic
1023661253 7:42473199-42473221 TGGAAAGTCTTGGGAAAACCAGG + Intergenic
1026366377 7:69652703-69652725 TGTAATGTCTTTTGAAAAAAAGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1032823255 7:135544246-135544268 TTTGTTTTCTTGGGAAAAAAGGG + Intergenic
1033156412 7:138960835-138960857 TTTGATCTCTTTGGAAAATCCGG - Intronic
1033813405 7:145044515-145044537 GGTGATTTGTTGGGAAAAATGGG + Intergenic
1034386414 7:150744631-150744653 TGGTGTGTCTTGGGAAAATCAGG - Intronic
1038500163 8:28037186-28037208 TGTAATGCTTGGGGAAAAACTGG - Intronic
1038849977 8:31266242-31266264 TGTGATGCCCTGGGAAAACCAGG - Intergenic
1038914436 8:32004781-32004803 TGTGGTGTGGTGGGAAAAATGGG + Intronic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1040721637 8:50330972-50330994 TGTGATTTCTGAGGAGAAACAGG + Intronic
1042374960 8:68039730-68039752 TGGGATGTTGAGGGAAAAACAGG - Intronic
1042974937 8:74458326-74458348 AGTGGTGTCTTGGGACAATCTGG - Intronic
1042993280 8:74664963-74664985 TTTGATTTCTTGAGAAAACCAGG - Intronic
1043540413 8:81255973-81255995 TGTGCTGTCCTTTGAAAAACAGG - Intergenic
1045356913 8:101397390-101397412 TGTGATAACTTGGGAACATCCGG + Intergenic
1047825294 8:128566917-128566939 TGTAATGTCTTTAGAAACACTGG + Intergenic
1049215377 8:141405403-141405425 TGGGTGGTCTTGGGGAAAACTGG - Intronic
1049963008 9:754425-754447 TTTCATATCTTGGTAAAAACTGG - Intergenic
1050129376 9:2395654-2395676 TGTGATTTCTTTGGACAACCTGG + Intergenic
1051048432 9:12902608-12902630 TGGCATGTCTTGGGAATGACAGG - Intergenic
1051435516 9:17026867-17026889 TGTTATGTTGTTGGAAAAACTGG - Intergenic
1051847211 9:21465276-21465298 TGTGCTTTCTGGGGAAACACAGG + Intergenic
1053333639 9:37241666-37241688 TGTGTTATCTAGAGAAAAACAGG - Intronic
1055150026 9:72985654-72985676 TGTGATCACTTGTGAAATACTGG + Intronic
1056577536 9:87867963-87867985 TGTGATGACTTTGGAAGCACTGG - Intergenic
1056650051 9:88451467-88451489 TGTGGTGTTTTGGGTGAAACTGG + Intronic
1056674608 9:88664577-88664599 TGGGATTTGTTGGGAAAGACTGG - Intergenic
1057202872 9:93152247-93152269 TGTGAAGTCCAGGGAGAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058836763 9:108864220-108864242 TGTGATGGCTTAGTAAGAACTGG - Intergenic
1059357320 9:113710139-113710161 TGTGCTGTCTTGAGAAAAGAAGG + Intergenic
1059778143 9:117497525-117497547 TGTGATTTCTTGTTAAAAACTGG + Intergenic
1059897866 9:118888400-118888422 TCTGATGTCATGGAAATAACAGG - Intergenic
1061408705 9:130406530-130406552 GGTGATGTCTAGGGAGACACAGG + Intronic
1186817540 X:13252655-13252677 TTTGATGTTTTGGAATAAACTGG + Intergenic
1188002666 X:24996708-24996730 TGTGTTGTATTCAGAAAAACGGG + Exonic
1189172467 X:38923221-38923243 TGTGAAGATTTGGGTAAAACAGG - Intergenic
1191274913 X:58532914-58532936 TGGGATATCTTCAGAAAAACTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193085205 X:77442788-77442810 AGTGAAGGCCTGGGAAAAACAGG - Intergenic
1195677378 X:107517382-107517404 TGAGATTTCTTGGGGAAAATGGG + Intergenic
1197192889 X:123668206-123668228 TGTGTTGTCTTCTGAAAAAATGG - Exonic
1197809725 X:130430448-130430470 TGTGTTGTTATGAGAAAAACGGG + Intergenic
1198041995 X:132862090-132862112 ACTAATGACTTGGGAAAAACTGG - Intronic
1199042004 X:143125509-143125531 TGTGATGTACAGAGAAAAACTGG - Intergenic
1200789410 Y:7286350-7286372 TGTGCTGTGTTGGGTAACACAGG + Intergenic
1201334815 Y:12869388-12869410 TGTGATTTATTATGAAAAACAGG - Intergenic