ID: 1022065524 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:26851780-26851802 |
| Sequence | GGGAGATTATCTAGAGTAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 189 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 180} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022065520_1022065524 | 15 | Left | 1022065520 | 7:26851742-26851764 | CCTCAAACTGTAAAATCTGTATT | No data | ||
| Right | 1022065524 | 7:26851780-26851802 | GGGAGATTATCTAGAGTAGAAGG | 0: 1 1: 0 2: 0 3: 8 4: 180 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022065524 | Original CRISPR | GGGAGATTATCTAGAGTAGA AGG | Intronic | ||