ID: 1022065524

View in Genome Browser
Species Human (GRCh38)
Location 7:26851780-26851802
Sequence GGGAGATTATCTAGAGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022065520_1022065524 15 Left 1022065520 7:26851742-26851764 CCTCAAACTGTAAAATCTGTATT No data
Right 1022065524 7:26851780-26851802 GGGAGATTATCTAGAGTAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022065524 Original CRISPR GGGAGATTATCTAGAGTAGA AGG Intronic