ID: 1022078076

View in Genome Browser
Species Human (GRCh38)
Location 7:26993129-26993151
Sequence GGGGTGCTCTCTTGGAGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022078076_1022078088 -2 Left 1022078076 7:26993129-26993151 CCTAGCCTCCAAGAGAGCACCCC 0: 1
1: 0
2: 0
3: 19
4: 228
Right 1022078088 7:26993150-26993172 CCTTTTGGGTGGGCAGCCTGGGG 0: 1
1: 1
2: 1
3: 20
4: 232
1022078076_1022078086 -3 Left 1022078076 7:26993129-26993151 CCTAGCCTCCAAGAGAGCACCCC 0: 1
1: 0
2: 0
3: 19
4: 228
Right 1022078086 7:26993149-26993171 CCCTTTTGGGTGGGCAGCCTGGG No data
1022078076_1022078089 12 Left 1022078076 7:26993129-26993151 CCTAGCCTCCAAGAGAGCACCCC 0: 1
1: 0
2: 0
3: 19
4: 228
Right 1022078089 7:26993164-26993186 AGCCTGGGGAAAAGCACTTCAGG 0: 1
1: 1
2: 0
3: 29
4: 236
1022078076_1022078084 -4 Left 1022078076 7:26993129-26993151 CCTAGCCTCCAAGAGAGCACCCC 0: 1
1: 0
2: 0
3: 19
4: 228
Right 1022078084 7:26993148-26993170 CCCCTTTTGGGTGGGCAGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022078076 Original CRISPR GGGGTGCTCTCTTGGAGGCT AGG (reversed) Intronic
900290584 1:1921990-1922012 GGAGGGCTCTCCTGGGGGCTGGG + Exonic
902398658 1:16145655-16145677 TGGGGGCTCTGTTGGAGGCAGGG - Intronic
903328745 1:22586210-22586232 GTGGGGCTCACTTTGAGGCTGGG + Intronic
903846470 1:26282291-26282313 CGGGTGCTTTATTGGGGGCTGGG + Exonic
910221342 1:84892604-84892626 GGGGTTCTCTCGTGAAGCCTAGG - Intronic
911070808 1:93830553-93830575 GGGTTTTTCTCTTGGAGGCAGGG - Intronic
917873913 1:179267691-179267713 TGGGGGCTATCTTGGAGGCTAGG + Intergenic
922179547 1:223223332-223223354 TGGGTGCTCTCTTGGCACCTGGG + Exonic
922368419 1:224887162-224887184 CTGGTGCCCTCTTGGAGGCCTGG - Intergenic
923196639 1:231674935-231674957 CTGGGGCTCTTTTGGAGGCTGGG + Intronic
924446709 1:244139588-244139610 GCGGTGCTCTCTTGTAGTCAGGG + Intergenic
924727628 1:246684921-246684943 GGGGTGTTCTCTTGCGGGCAGGG - Intergenic
924792803 1:247268988-247269010 GAGGTGCTATCTGGGAGGCAAGG + Intergenic
1063384554 10:5607882-5607904 GGGGTGCCCTCCTGGAGCCTTGG - Intergenic
1064312094 10:14220716-14220738 GGGGTGCCTCCATGGAGGCTTGG + Intronic
1065862052 10:29880071-29880093 GTGGTGCTCTTCTGGGGGCTTGG + Intergenic
1067208537 10:44239694-44239716 GGGCTGCTGTCTTGGTGCCTGGG + Intergenic
1068491374 10:57728743-57728765 GTGGTGCTCTCTTACAGCCTTGG + Intergenic
1068734694 10:60399540-60399562 GGAGAGCTCTCTGGGAGTCTTGG + Intronic
1069834567 10:71300599-71300621 GTGGTGCTCTCTTGATGGCCAGG + Exonic
1071186971 10:83057688-83057710 GGGTTGCTCTCTTGCAGGCAGGG - Intergenic
1074823355 10:117197777-117197799 GGGCTGCCTTCTAGGAGGCTGGG + Intronic
1076409671 10:130236970-130236992 CGGGTCCTCACTAGGAGGCTTGG + Intergenic
1076895041 10:133306922-133306944 GGGCTGCCCTCTTGGAGGCCCGG - Intronic
1077076355 11:704173-704195 GGTGTGCTCTCTTGCAGGGCAGG - Intronic
1078402467 11:11040171-11040193 TGGAGGCTCTCTTGGAGCCTAGG + Intergenic
1079449760 11:20589647-20589669 AGGATCCTCTCTTGGAGTCTCGG - Intergenic
1081628223 11:44668302-44668324 GGGCAGCTCTACTGGAGGCTGGG + Intergenic
1083827655 11:65212364-65212386 GGGGAGCTCTCTGGGGGGCCGGG - Intergenic
1084313768 11:68331943-68331965 GGGGTGCTGTCTGGGTGACTGGG + Intronic
1085181201 11:74538128-74538150 GGGTTGCTCTCTTGTGGGCAAGG + Intronic
1087675201 11:101153703-101153725 GGGGAGCACACTTGGAGGCAGGG - Intergenic
1090617890 11:128532789-128532811 GCTGTGATCTCTTGGAGCCTAGG - Intronic
1091681955 12:2533606-2533628 GGTGTGCTCTCTGGGAGCTTCGG + Intronic
1092429197 12:8396193-8396215 CGGATGCTGTCTGGGAGGCTTGG - Intergenic
1094183843 12:27620068-27620090 GAGGTGTTCTATTGGTGGCTCGG - Intronic
1094462158 12:30708128-30708150 GGACTGCTCTCTTGGTGGGTGGG + Intergenic
1094641662 12:32281873-32281895 GGGGTGCTCTTCTGGATCCTGGG + Intronic
1100263827 12:92957221-92957243 GGGTTGTTCTCTTGCAGGCAGGG + Intergenic
1102157703 12:110743800-110743822 GGAGTGCCCTCGGGGAGGCTGGG - Intergenic
1102462063 12:113106050-113106072 GGGATGCAATCATGGAGGCTGGG + Intronic
1102521181 12:113478226-113478248 GGGGTTCTATTTTGGAGGATGGG - Intergenic
1102522694 12:113488560-113488582 GGGCTCACCTCTTGGAGGCTTGG + Intergenic
1104891524 12:132142504-132142526 GGGCTGCTCTGCTGGAGGCCTGG + Intronic
1104946287 12:132416305-132416327 GGGGGCCTCTCTGGGAGGCCAGG - Intergenic
1105292967 13:19064549-19064571 GGGGCTCTGTCCTGGAGGCTGGG + Intergenic
1106621459 13:31374562-31374584 GGGTGGCTCCCTGGGAGGCTGGG - Intergenic
1106677713 13:31978672-31978694 GGGGTTCTCTTTTGGAGGATGGG + Intergenic
1107560176 13:41551188-41551210 GGGCTTCTCACATGGAGGCTCGG + Intergenic
1108832290 13:54495013-54495035 GGGTTGCTCTCTGGCAGGCAGGG - Intergenic
1110809010 13:79791355-79791377 TGGGTGCTGCCCTGGAGGCTAGG + Intergenic
1113655537 13:112066373-112066395 GGGGCGCTCCCTTGGACGCAGGG - Intergenic
1113955102 13:114096118-114096140 GGGGTGCTCTCTGGGTGGCCTGG + Intronic
1117553132 14:56856262-56856284 AGGGTGCTTTCTCGGGGGCTGGG - Intergenic
1117963658 14:61186344-61186366 AGGGTGTTCTCTTTGAGGCCAGG + Intergenic
1118477042 14:66127266-66127288 AATGTGCTCACTTGGAGGCTGGG + Intergenic
1120731591 14:88008917-88008939 GGGGTCCTCACTTGGAAACTAGG - Intronic
1121292261 14:92785728-92785750 GGGTTGCCCACTAGGAGGCTGGG + Intergenic
1122346698 14:101065389-101065411 GGGAGGCCGTCTTGGAGGCTGGG + Intergenic
1122574464 14:102732970-102732992 GGGGGGCTCTCTTGGGGGGTGGG - Intergenic
1125464688 15:39939210-39939232 TGGGTGCTCTCCTGGAAGCTGGG - Intronic
1128349922 15:66881779-66881801 GCGCTGCTCTCCTGGAGGCCTGG + Intergenic
1128986064 15:72222482-72222504 GGGCTGCTCTCCTGGAGCCAGGG - Intronic
1129313003 15:74725465-74725487 AGGGTGGACTCTTGGAGCCTGGG + Exonic
1130011320 15:80154844-80154866 GGGGTGCTCTCTGTGAAGGTAGG + Intronic
1130109620 15:80953769-80953791 GGCGTTCACTCATGGAGGCTGGG + Intronic
1132749306 16:1450134-1450156 GGGCTGCTCTCTGTGAGGCCGGG - Intronic
1133208760 16:4250662-4250684 GGGGTGATTTCTTTGAGGCGGGG - Intergenic
1133210884 16:4262831-4262853 GGGGTGCTCTCTGGGACACCGGG + Intronic
1135038466 16:19098220-19098242 TGTGTGGTCTCTTGGTGGCTTGG - Intergenic
1135255768 16:20940517-20940539 GGGAGGATCTCTTGGAGGCCAGG - Intronic
1135678017 16:24433635-24433657 GAGCTGCTCTCCTGGGGGCTGGG - Intergenic
1135955664 16:26954517-26954539 GGAGTGCCATGTTGGAGGCTTGG - Intergenic
1138201694 16:55093350-55093372 GTGGTGGGCTCTTGGAGGGTGGG + Intergenic
1139579768 16:67865578-67865600 GCTGAGCTCTCTTGGAGGCCTGG + Intronic
1140678887 16:77364353-77364375 GGTGTCCTCTGTGGGAGGCTTGG + Exonic
1141609553 16:85173548-85173570 GAGGTGCTGGCTTGCAGGCTGGG + Intronic
1141643813 16:85356909-85356931 GGGATGCTCTCTTCCAGACTGGG - Intergenic
1142111692 16:88335378-88335400 GGGGTGCTCTGTGGGCAGCTGGG + Intergenic
1142417808 16:89952604-89952626 TGGGTGCTCCCTGGGAGACTGGG + Intronic
1143465010 17:7130917-7130939 GGGGGGCTGTCTAGGAGGGTTGG - Intergenic
1144173303 17:12680905-12680927 GGGGTGCTCTATTGGGGTGTAGG - Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144659823 17:17060698-17060720 GGTGTTCTCCCTCGGAGGCTTGG + Intronic
1145094879 17:20016733-20016755 GTGGTGCTGTCAGGGAGGCTCGG - Intronic
1145162102 17:20582245-20582267 TGCGTGCTGACTTGGAGGCTAGG - Intergenic
1146464998 17:33079438-33079460 GGGGTGTTGTGTGGGAGGCTGGG + Intronic
1146948531 17:36890378-36890400 GGGGTGGGCCCTTGGGGGCTGGG - Intergenic
1148351044 17:46942504-46942526 GGGGTGCTCTGCTGGGGTCTGGG + Intronic
1148733190 17:49850347-49850369 GGGGAGCTCAGTGGGAGGCTGGG - Intergenic
1150220866 17:63495285-63495307 GGGAGGCTCCCTGGGAGGCTGGG + Intronic
1151222624 17:72624204-72624226 GTGCTGCTGTCCTGGAGGCTGGG - Intergenic
1151447630 17:74177520-74177542 GGGGTGAGCCCTTGGTGGCTTGG - Intergenic
1151567028 17:74904435-74904457 GGGGTGTTCTCATGGAGGAGAGG - Intergenic
1151958009 17:77390062-77390084 CTGTTGCCCTCTTGGAGGCTGGG + Intronic
1152008977 17:77699111-77699133 GAGGTCCTCTTCTGGAGGCTGGG + Intergenic
1203169005 17_GL000205v2_random:129948-129970 GTGGTGCCCTCTACGAGGCTGGG + Intergenic
1203174600 17_GL000205v2_random:185160-185182 GGGGTGACCTCTGTGAGGCTGGG - Intergenic
1156488003 18:37478793-37478815 GGGCTTCTCTCTTGGAACCTTGG + Intronic
1156605077 18:38656838-38656860 GGGGTCCTCTCTTGAGGTCTCGG + Intergenic
1157190988 18:45581326-45581348 GGGTTGCTCTCTAGGACCCTGGG - Intronic
1160032888 18:75278164-75278186 GGGGTGCTCCCCAGGAGCCTGGG - Intronic
1160575343 18:79849795-79849817 GGGGGGCTCTCAGAGAGGCTGGG - Intergenic
1161218988 19:3109301-3109323 GGGGGGCTCATCTGGAGGCTGGG + Intronic
1162054089 19:8052561-8052583 GGGGTGCTGGCTGGGAGGCCTGG + Intronic
1162286595 19:9743548-9743570 CTGGTGCCCTCTTGGAGGCCTGG - Intergenic
1162459118 19:10803778-10803800 GGGGTGCTCTCTCAGAGCCAGGG + Intronic
1165401673 19:35604777-35604799 GGGTTGTTCTCTTGCAGGCAGGG - Intergenic
1165808471 19:38596326-38596348 GGCGCGCTCTCTTGCTGGCTGGG - Exonic
1167496686 19:49823359-49823381 TGGGTGCTGTATTGGGGGCTGGG + Intronic
1168180955 19:54662937-54662959 GGTGTGGCCGCTTGGAGGCTGGG - Exonic
925194362 2:1911542-1911564 GGGGTGGTCTGTGGGAGGCTGGG - Intronic
925857965 2:8148979-8149001 TTGGTGCTCTTTTGGAAGCTTGG - Intergenic
925929190 2:8693898-8693920 ACGGTGCTCTCATGGAGCCTGGG - Intergenic
926027713 2:9558980-9559002 TGGGGGCCATCTTGGAGGCTGGG - Intergenic
927321710 2:21754985-21755007 GTGGTGCTCTCTGGGAAGGTAGG + Intergenic
927756358 2:25711422-25711444 TGGGTGCACTTTGGGAGGCTGGG + Intergenic
933349697 2:81137559-81137581 GGGATTTTCTCATGGAGGCTAGG + Intergenic
934646044 2:96059968-96059990 GGGGTAGTGTCTTGGAGGCGGGG - Intergenic
934711954 2:96522173-96522195 GGCTTACTCTTTTGGAGGCTGGG - Intergenic
934839448 2:97616058-97616080 GGGGTAGTGTCTTGGAGGCGGGG - Intergenic
935497422 2:103798011-103798033 GGGATGCTCTATTGGGTGCTGGG - Intergenic
937976364 2:127584376-127584398 TGGGTCTCCTCTTGGAGGCTGGG + Intronic
938597741 2:132805685-132805707 AGAGTGCTCACTTGCAGGCTAGG + Intronic
944906886 2:204270636-204270658 GGGTTGTTCTCTTGCAGGCAGGG + Intergenic
945554426 2:211261987-211262009 GGGTTGTTCTCTTGCAGGCAGGG - Intergenic
945857856 2:215090112-215090134 GGGTTGTTCTCTTGCAGGCAGGG - Intronic
946237136 2:218330938-218330960 TGAGTGCTCCCTTGCAGGCTGGG - Intronic
946293463 2:218764179-218764201 GTGGTGTGATCTTGGAGGCTAGG + Intergenic
946404241 2:219484132-219484154 GTGGTGCAGGCTTGGAGGCTCGG - Exonic
946863195 2:224019564-224019586 GGGGTGCCATGCTGGAGGCTGGG - Intronic
947700667 2:232231648-232231670 TGGGTGCTCTCTTGCAGACCTGG + Intronic
948565342 2:238882852-238882874 GGGTTGCTCTGCTGGAAGCTGGG + Intronic
949045168 2:241869549-241869571 GGGATGCTCTCTGGGGGGCGGGG + Intergenic
1168806360 20:674592-674614 GGGGTGATCTCTGGAAGGCAGGG - Intronic
1170249305 20:14262685-14262707 GGAGTGGTGTCATGGAGGCTAGG + Intronic
1171412502 20:24956669-24956691 GGGGTGCCCTCCTGGGGGCTGGG + Intronic
1171852412 20:30317952-30317974 GGGGTGCTGTCTGTGAGGCTGGG + Intergenic
1172240324 20:33408640-33408662 GGTGTGCACTCTCGGAGGCCAGG - Intronic
1172576221 20:36010876-36010898 GGGCTGTTCTCCTGGAGGCAGGG - Intronic
1173708714 20:45135868-45135890 TGGGTGCTGGCCTGGAGGCTAGG + Intergenic
1175814659 20:61877215-61877237 GGGGAGATCTCTGGGTGGCTGGG - Intronic
1176103103 20:63373395-63373417 GGGCTTCCCTCTGGGAGGCTGGG - Intronic
1176332925 21:5565782-5565804 GGGGTGACCTCTGTGAGGCTGGG - Intergenic
1176394832 21:6255170-6255192 GGGGTGACCTCTGTGAGGCTGGG + Intergenic
1176402751 21:6329204-6329226 GTGGTGCCCTCTACGAGGCTGGG - Intergenic
1176434406 21:6659900-6659922 GTGGTGCCCTCTACGAGGCTGGG + Intergenic
1176442325 21:6733935-6733957 GGGGTGACCTCTGTGAGGCTGGG - Intergenic
1176458668 21:6986970-6986992 GTGGTGCCCTCTACGAGGCTGGG + Intergenic
1176466587 21:7061004-7061026 GGGGTGACCTCTGTGAGGCTGGG - Intronic
1176490148 21:7442782-7442804 GGGGTGACCTCTGTGAGGCTGGG - Intergenic
1177716547 21:24846584-24846606 GGGGTGCCCCCTCTGAGGCTAGG + Intergenic
1181037798 22:20178277-20178299 GGGGTGGGCCCTTGGAGGCTTGG + Intergenic
1181807812 22:25385603-25385625 GGGGTGCTGTCTGGGTGGCTGGG - Intronic
1182435028 22:30325163-30325185 GGGGTGCTCTCTCTGAGTCCTGG + Intronic
1183745608 22:39689880-39689902 AGGGTGCTCTCATGGCCGCTGGG + Intergenic
1184866669 22:47205332-47205354 GTTGGGCTCTCTTGAAGGCTGGG + Intergenic
1185324830 22:50220466-50220488 GGGGGGCTCTGTTGGGGCCTGGG + Exonic
950447816 3:13048302-13048324 GTGATGCTTTCCTGGAGGCTGGG + Intronic
953714665 3:45306996-45307018 GTGGTGCTCGTTGGGAGGCTCGG - Intergenic
954212952 3:49108588-49108610 GGGGTGCTGGCTTGGAGCCCTGG + Intronic
954689635 3:52388765-52388787 GGGGTGGGCTCTGGGAGGCTGGG - Intronic
954700859 3:52450279-52450301 GTGATGCTGTCTTGGAGGCGTGG - Intergenic
954813120 3:53260103-53260125 AAGGTGCTCTGTTGGAGGGTAGG + Intergenic
955275869 3:57546207-57546229 GGGGTGCCCCCTATGAGGCTGGG - Intergenic
957077664 3:75614402-75614424 GAGGTGCTCTTCTGCAGGCTTGG - Intergenic
958676246 3:97272634-97272656 GGGGTGTTCTCTGGCAGGCAGGG + Intronic
958755454 3:98245705-98245727 CTGGTGCCCTCTTGGAGGCCTGG - Intergenic
961625665 3:128261983-128262005 GTGGTGCTGTCTTCTAGGCTTGG + Intronic
962065473 3:131975150-131975172 GCGGTTCTCTCTTGCAGGATAGG - Intronic
962288244 3:134106473-134106495 GGGGTGTTCTTTAGGGGGCTGGG + Intronic
966982593 3:185152496-185152518 GGGCTGCTCTGCCGGAGGCTGGG - Intronic
967271780 3:187738647-187738669 GGGGTGCGCTTTCGGGGGCTAGG + Intronic
968656336 4:1779907-1779929 GAGGTGCTCGCTGGGTGGCTGGG + Intergenic
969585273 4:8087962-8087984 GGGGTGCTGAGTTGGGGGCTTGG - Intronic
972558046 4:40200069-40200091 GGGGTGCACAGGTGGAGGCTGGG + Intronic
975883419 4:78938391-78938413 GTGGTGCTCTAGTGGAGACTGGG + Intronic
978311459 4:107388442-107388464 GGTGTGCTCTCATGGCGACTGGG + Intergenic
980714341 4:136612003-136612025 CTGGTGCCCTCTTGGAGGCCTGG - Intergenic
982169470 4:152646751-152646773 GGGGTTGTCTGGTGGAGGCTAGG + Intronic
984412261 4:179409100-179409122 GGGGTGTTCTCTGGCAGGCAGGG - Intergenic
985601348 5:836116-836138 GTGACCCTCTCTTGGAGGCTGGG - Intronic
985660202 5:1153235-1153257 GGGGTGGGTGCTTGGAGGCTGGG - Intergenic
985809796 5:2074603-2074625 GGGCTGCTTTCTGGGAGTCTTGG + Intergenic
986121180 5:4837845-4837867 GGGCAGCTCTCGGGGAGGCTCGG - Intergenic
986756447 5:10840608-10840630 GAGGTGCTGTCTTGGTGACTTGG - Intergenic
986807474 5:11321985-11322007 GGGGAGCTCTGTTGGAAACTGGG + Intronic
988825785 5:34932981-34933003 GGGGTGCTGTCTTGCAAGCTGGG + Intronic
989659659 5:43786667-43786689 GGGCTGTTCTCTTGCAGGCAGGG - Intergenic
991189311 5:63850733-63850755 CTGGTGTTCTCTTGCAGGCTTGG - Intergenic
991593634 5:68279886-68279908 TGGGTCTTCTCTTGGATGCTTGG - Intronic
995471089 5:112503014-112503036 GGGTTGTTCTCTTGTAGGCAGGG - Intergenic
995787246 5:115842448-115842470 GGGGTGGGCTCTTGGGGACTGGG - Intronic
997851005 5:137332432-137332454 TAGGTGCTCTGTTGGGGGCTGGG - Intronic
998003088 5:138639957-138639979 GAGATGCTCTCTTGGCTGCTAGG + Intronic
1000876026 5:166639165-166639187 TGGGTGCTCCCCTGGAGCCTGGG - Intergenic
1001933730 5:175690266-175690288 GGGGTGCTCTCCTGGGGTGTTGG + Intergenic
1002305048 5:178278288-178278310 GGGCAGCTCTCAGGGAGGCTGGG - Intronic
1005785863 6:29245647-29245669 GGGTTGTTCTCTTGCAGGCAGGG + Intergenic
1005990776 6:30900384-30900406 GGGGTGCTCTGGTGGAGGCCTGG + Intergenic
1006133079 6:31880300-31880322 GGGGTGGGCTCTTGGTGGCTGGG - Intronic
1007398514 6:41590496-41590518 GCGGGGCTCTCCTGCAGGCTGGG + Intronic
1008617664 6:53241818-53241840 TGGGGGCCATCTTGGAGGCTGGG + Intergenic
1009465289 6:63961433-63961455 GGGTTTCTCTCTTGCAGGCAGGG - Intronic
1013048996 6:106513089-106513111 GGGGTCCGCTCTGAGAGGCTCGG + Intronic
1018251715 6:161878008-161878030 GAGGTGTTCTCTTGAAGGGTGGG + Intronic
1020308164 7:6850453-6850475 GAGGTGCTCTTCTGCAGGCTTGG - Intergenic
1021116015 7:16747480-16747502 GGAGGGAACTCTTGGAGGCTGGG - Intergenic
1022078076 7:26993129-26993151 GGGGTGCTCTCTTGGAGGCTAGG - Intronic
1022101568 7:27172553-27172575 GGGGTGCTTACTTGGAAGATGGG + Intronic
1024229960 7:47356152-47356174 GGCCAGCTCTCCTGGAGGCTGGG + Intronic
1024402501 7:48941221-48941243 GGGTTGTTCTCTTGCAGGCAGGG - Intergenic
1033683725 7:143620726-143620748 GCGGGGCTGTCTTGGAGGCTAGG - Intergenic
1033700887 7:143836912-143836934 GCGGGGCTGTCTTGGAGGCTAGG + Intergenic
1034994003 7:155566538-155566560 GGGGTGCCCTGGTGGAGGATGGG + Intergenic
1036751213 8:11444601-11444623 AGGGCGCCCTCCTGGAGGCTCGG + Exonic
1037876848 8:22552617-22552639 GAACTGCTCTCTTGGAGGATGGG - Intronic
1038052691 8:23828335-23828357 GGGGTGCTTTCCTGGAGTCCTGG + Intergenic
1040561302 8:48525432-48525454 AGGGAGCTCTTGTGGAGGCTGGG + Intergenic
1042722947 8:71844088-71844110 GGGGCGGCCTCTTGGAGGCGGGG + Exonic
1044587159 8:93878526-93878548 GGGTTGTTCTCTTGGGGGCAGGG + Intronic
1044928040 8:97225586-97225608 GGGGTGCTATGTTTGAGGTTTGG + Intergenic
1048097068 8:131308445-131308467 GGGTTGTTCTCTTGCAGGCAGGG - Intergenic
1049100967 8:140578667-140578689 GGGTCACTCTCTTAGAGGCTGGG - Intronic
1050779053 9:9307286-9307308 CAGTTTCTCTCTTGGAGGCTAGG + Intronic
1050898075 9:10909447-10909469 GGGTTGTTCTCTTGCAGGCAGGG - Intergenic
1052584779 9:30411946-30411968 GGGGTGCCCCCTATGAGGCTGGG - Intergenic
1058144070 9:101391121-101391143 GGGGTGGGATCTTGGAGGATGGG - Intronic
1058632107 9:106999973-106999995 GGGGTGAGCTCTTGAAGGCGGGG + Intronic
1061002472 9:127910174-127910196 GGGGGGCTCTGGGGGAGGCTGGG + Intronic
1061963563 9:134000278-134000300 GGGGTGCTGTCTAGCAGGGTAGG - Intergenic
1061963950 9:134002942-134002964 GGGGTGGGCTCCTGGGGGCTTGG + Intergenic
1062364004 9:136200379-136200401 TGGGTGCTCCCTGGGTGGCTGGG - Intronic
1062400075 9:136368490-136368512 GGGCTGCTCTCATGGGGGCCGGG + Intronic
1062573445 9:137195851-137195873 GGGCTGCTTTCCTGGAGGGTGGG - Intronic
1062601100 9:137318923-137318945 GGGGTGCTCTCTGGGTGGTACGG - Intronic
1203429162 Un_GL000195v1:74501-74523 GGGGTGACCTCTGTGAGGCTGGG + Intergenic
1203437129 Un_GL000195v1:148745-148767 GTGGTGCCCTCTACGAGGCTGGG - Intergenic
1188301334 X:28507634-28507656 GGGTTGTTCTCTTGCAGGCAGGG + Intergenic
1188749944 X:33892994-33893016 GAGGTGCTCTCTGGGAGACAGGG + Intergenic
1189134302 X:38532968-38532990 GGGGTGGCTTCTTGGAGGCCAGG + Intronic
1192191298 X:68992883-68992905 AGGCTGCTCTCCTGCAGGCTAGG - Intergenic
1193194784 X:78619291-78619313 GTGATGCTCTCTAGGAGCCTGGG + Intergenic
1194290435 X:92065025-92065047 CAGGTGGTCTCTGGGAGGCTGGG + Intronic
1196562954 X:117172973-117172995 GGGGAGCTCTCTTGCACACTGGG + Intergenic
1199619067 X:149683205-149683227 GGGGTTTTCTCTTGCAGGCAGGG - Intergenic
1200607947 Y:5289624-5289646 CAGGTGGTCTCTGGGAGGCTGGG + Intronic
1201240294 Y:11952299-11952321 GGGTTGTTCTCTTGCAGGCAGGG + Intergenic