ID: 1022078886

View in Genome Browser
Species Human (GRCh38)
Location 7:27000338-27000360
Sequence CACAGCTATTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022078883_1022078886 12 Left 1022078883 7:27000303-27000325 CCCTGCTGTCTTCTGCAGATACT No data
Right 1022078886 7:27000338-27000360 CACAGCTATTGGCCTGTTACTGG No data
1022078884_1022078886 11 Left 1022078884 7:27000304-27000326 CCTGCTGTCTTCTGCAGATACTC No data
Right 1022078886 7:27000338-27000360 CACAGCTATTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022078886 Original CRISPR CACAGCTATTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr