ID: 1022088003

View in Genome Browser
Species Human (GRCh38)
Location 7:27087830-27087852
Sequence GAGGGGCGAGGCCTCTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022087995_1022088003 7 Left 1022087995 7:27087800-27087822 CCTTTCCCCTTTCAAATCTTAGA No data
Right 1022088003 7:27087830-27087852 GAGGGGCGAGGCCTCTGACCTGG No data
1022087997_1022088003 1 Left 1022087997 7:27087806-27087828 CCCTTTCAAATCTTAGAGACAGA No data
Right 1022088003 7:27087830-27087852 GAGGGGCGAGGCCTCTGACCTGG No data
1022087996_1022088003 2 Left 1022087996 7:27087805-27087827 CCCCTTTCAAATCTTAGAGACAG No data
Right 1022088003 7:27087830-27087852 GAGGGGCGAGGCCTCTGACCTGG No data
1022087998_1022088003 0 Left 1022087998 7:27087807-27087829 CCTTTCAAATCTTAGAGACAGAC No data
Right 1022088003 7:27087830-27087852 GAGGGGCGAGGCCTCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022088003 Original CRISPR GAGGGGCGAGGCCTCTGACC TGG Intergenic