ID: 1022088808

View in Genome Browser
Species Human (GRCh38)
Location 7:27094656-27094678
Sequence TGCAGCGATCTCCACCCTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022088804_1022088808 13 Left 1022088804 7:27094620-27094642 CCAGATCTTCACTTGGGTCTCGT 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1022088808 7:27094656-27094678 TGCAGCGATCTCCACCCTGCGGG 0: 1
1: 0
2: 1
3: 12
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022088808 Original CRISPR TGCAGCGATCTCCACCCTGC GGG Exonic
900458605 1:2789565-2789587 TGCAGCGATCTCCACGCGCCGGG - Exonic
900996993 1:6128150-6128172 TGCGGCCATCTCCAAGCTGCTGG - Exonic
904945550 1:34196394-34196416 TGCAGGGATCTCCCCACTGCTGG + Intronic
905244115 1:36600850-36600872 TGCAGGGACCTCCATCCTGGAGG + Intergenic
908819228 1:68066220-68066242 TTCAGAGATCTCCACCCCTCTGG - Intergenic
910537775 1:88318985-88319007 TGCGTTGATCTCCACCCTCCTGG + Intergenic
915300490 1:154948651-154948673 TGCAGCTATTACCACCCTCCTGG + Intronic
920735864 1:208532669-208532691 TCAAGCTCTCTCCACCCTGCTGG + Intergenic
923290425 1:232539925-232539947 TGCAGCTTTCTCCATACTGCAGG - Intronic
1063861449 10:10312186-10312208 TCCACCCATCTCCGCCCTGCTGG - Intergenic
1070986078 10:80690958-80690980 TGCAGCCATCTCTTCCCTTCAGG - Intergenic
1072608829 10:97003548-97003570 TGGGGCCATCTCCACCCTGTGGG - Intronic
1074765206 10:116695193-116695215 ACCACCGACCTCCACCCTGCAGG + Intronic
1075732145 10:124642790-124642812 TAGACCGACCTCCACCCTGCAGG - Intronic
1075912445 10:126136443-126136465 TGCAGAGACCTGCACCCAGCTGG - Intronic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1076155287 10:128200257-128200279 TGCATCCATCTCAAGCCTGCTGG + Intergenic
1077266397 11:1652950-1652972 TGCAGCTCCCTCCACCCGGCTGG - Intergenic
1080853114 11:36088549-36088571 TGCACAGAGCTCCACACTGCTGG + Intronic
1082188088 11:49208532-49208554 TGGAGCGAATTCCAGCCTGCAGG - Exonic
1082783712 11:57305003-57305025 TGCAGCTACGTCCACCCCGCCGG + Intronic
1083991786 11:66250634-66250656 AGGAGGGATGTCCACCCTGCAGG + Intergenic
1086517117 11:87625364-87625386 TCCAGCCTTCTCCACCCTGAAGG - Intergenic
1090386223 11:126358870-126358892 AGCAGCAACCTCCTCCCTGCTGG - Intronic
1091345795 11:134853144-134853166 TGCAGCCCTCTCCACCGCGCAGG - Intergenic
1091813836 12:3421397-3421419 TCCAGCCATCACCATCCTGCCGG + Intronic
1092196671 12:6554129-6554151 TTCAGGGATCTCCACCCTGCTGG - Intronic
1092845192 12:12578430-12578452 TGCAGCGGTATCCACCCTCCAGG - Intergenic
1093498375 12:19782774-19782796 CACTGCGACCTCCACCCTGCAGG - Intergenic
1095839587 12:46677834-46677856 TGCAGCTATCTCCTCTCTGGTGG + Intergenic
1103788153 12:123449177-123449199 TGCAGCGCCTTCCATCCTGCTGG + Intergenic
1106562322 13:30857377-30857399 AGCAGCGATCTCCACTGTGAAGG + Intergenic
1110265365 13:73531165-73531187 CGCAGCGGTCTCAACCCTGCAGG + Intergenic
1112227090 13:97550466-97550488 TGCTGCAATTTCCAACCTGCTGG - Intergenic
1115319123 14:32059608-32059630 TGCATCTATCTCCACACAGCAGG + Intergenic
1116515186 14:45796258-45796280 TGCAGTGGGCTCCACCCTGTTGG - Intergenic
1119847228 14:77839557-77839579 TGCACTGCTCTCCACCCTGCAGG - Intronic
1129054457 15:72809078-72809100 TACAGCTATCTGCATCCTGCTGG + Intergenic
1132581708 16:687739-687761 TGCATCGACCTCCTGCCTGCAGG - Exonic
1132943852 16:2521334-2521356 CGCAGCTGTCTCCACACTGCTGG + Intronic
1133617181 16:7488187-7488209 TGCAGCGTGCTCATCCCTGCAGG + Intronic
1138392962 16:56683494-56683516 TGCAGCCTTCTTCACCCTTCTGG + Intronic
1138622419 16:58222663-58222685 AGGAGCCATCTCCACCCTCCTGG - Intergenic
1139040216 16:62991207-62991229 TACAGGGATCACCACCCTGTGGG - Intergenic
1141529859 16:84638561-84638583 TGCACCCATCTCCTGCCTGCTGG - Intergenic
1147582980 17:41637227-41637249 TGCTGCGCTCTCCAGCATGCTGG - Intergenic
1148547616 17:48529739-48529761 GGCGGCAATCTCCACCCTCCGGG + Exonic
1152192264 17:78896086-78896108 TGCAGCCAGCTCCATCCTTCAGG + Intronic
1155178910 18:23326057-23326079 TGCAGCCATCTCCAAAATGCTGG + Intronic
1158847975 18:61464593-61464615 TGCAGCAAGCTCTACCCTGCTGG - Intronic
1161561741 19:4977172-4977194 TCCAGCCATCTCCGCCCTGCTGG + Intronic
1162070365 19:8149150-8149172 GGGCGCGATCTCCACCCGGCAGG + Intronic
1166551632 19:43669329-43669351 CCCAGCGCTCTCCACGCTGCTGG - Intronic
1167949466 19:53014775-53014797 AACTGCGATTTCCACCCTGCTGG - Exonic
1167954034 19:53049936-53049958 AACTGCGATTTCCACCCTGCTGG - Exonic
924998269 2:384021-384043 TGAAGCCAGCCCCACCCTGCAGG + Intergenic
926961417 2:18362314-18362336 TGTGGCCATCTCCACTCTGCCGG - Intergenic
927152545 2:20204157-20204179 TGCCTCCACCTCCACCCTGCCGG - Exonic
928911953 2:36430670-36430692 TGAAGGCATCTCCACCCTTCTGG - Intronic
933729898 2:85448603-85448625 TGCCCCGTTCTCCACCCTCCAGG + Intergenic
938472881 2:131582013-131582035 TTCAGCTTTCTCCACCTTGCTGG + Intergenic
939934634 2:148275471-148275493 TGCAGAAATTTCCAGCCTGCTGG - Intronic
940037751 2:149329230-149329252 GGCAGCGATCTCCACCTTGAGGG + Intergenic
944444812 2:199778554-199778576 TGCTGAGCTCACCACCCTGCTGG - Intronic
948490084 2:238307105-238307127 TGCAGCGTTCTTCCCCATGCTGG + Intergenic
948674939 2:239591693-239591715 TGGAGCAATCTACACCCTGCTGG - Intergenic
1169580379 20:7016336-7016358 TGCAGTGCTTTCCACCCTGAAGG + Intergenic
1172207303 20:33173087-33173109 AGCAAAGATCTCCACCCTGAAGG - Intronic
1179190071 21:39115968-39115990 TGCTGCGACCTCAACCCTCCAGG + Intergenic
1179728573 21:43354443-43354465 GGCAGGCATCCCCACCCTGCGGG + Intergenic
1183654569 22:39177218-39177240 TTCAGAGACCTCCACTCTGCAGG + Intergenic
1185084643 22:48733720-48733742 TTCAGCAAACTCCAGCCTGCAGG + Intronic
1185173000 22:49304367-49304389 TGCTGGGAGCTCCACCCTGCTGG - Intergenic
1185380570 22:50505870-50505892 GGCACCCACCTCCACCCTGCAGG + Intronic
952758083 3:36889877-36889899 TGCAGCCATCCCCATCCTTCTGG + Exonic
953492238 3:43362120-43362142 GGCAGCAATCTCCACTCAGCAGG - Intronic
956294037 3:67692842-67692864 TGCAGGAATCCCCACTCTGCCGG + Intergenic
958471172 3:94522670-94522692 TGCAGCACTCTCCCCTCTGCAGG - Intergenic
960934699 3:122891160-122891182 TGCAGCACTCTCCACGCTGGTGG + Intergenic
968595520 4:1480302-1480324 TGCTGGGTTCTCCACCCAGCTGG + Intergenic
972355075 4:38272920-38272942 TGCAGTGATCTCCAGGTTGCTGG - Intergenic
985661527 5:1159455-1159477 TGCAGCCATCTCCCCACTGAGGG - Intergenic
990786055 5:59421393-59421415 TGAAGTGATCTCCACATTGCTGG - Intronic
990941785 5:61209456-61209478 AGCAGGGATCTCCAACCTGGGGG - Intergenic
994229632 5:97298555-97298577 TCTAGCGATCACCCCCCTGCAGG - Intergenic
1001025036 5:168216838-168216860 TGGAATCATCTCCACCCTGCTGG + Exonic
1001453797 5:171845804-171845826 TGCAGCCTTCTCCACCCCACAGG - Intergenic
1004403322 6:15308932-15308954 TACTACGATTTCCACCCTGCAGG - Intronic
1004431253 6:15546014-15546036 TTCAGCCAGCTCCACCCTCCTGG - Intronic
1007715823 6:43855544-43855566 TGCTGCGATGTCACCCCTGCAGG - Intergenic
1011866055 6:91829513-91829535 TACAGCCATCTGCACCCTCCAGG + Intergenic
1013501039 6:110751596-110751618 TGAAACCATCCCCACCCTGCTGG + Intronic
1013507358 6:110814455-110814477 AGCAGCGATCTCCGCCCTTCGGG - Intronic
1017417554 6:154237290-154237312 TACAGCGTTTTCCACCCTGGAGG - Intronic
1019165496 6:170095320-170095342 TCCAGGGATCTCCAGCCTGTGGG + Intergenic
1022088808 7:27094656-27094678 TGCAGCGATCTCCACCCTGCGGG + Exonic
1022089898 7:27101323-27101345 CGCTGCAATCTCCACCCTTCGGG + Exonic
1027493643 7:78860877-78860899 TGCAGTGGGCTCCACCCTGTTGG + Intronic
1028190555 7:87845619-87845641 TGCAGTGATCTCCAACCTTTTGG - Intronic
1029626362 7:101722549-101722571 TGGAGCCATCTCCACCCTCTTGG + Intergenic
1032773858 7:135090081-135090103 TGCAGCCATATCCTGCCTGCTGG - Intronic
1034559025 7:151867894-151867916 TGCAGTGACCTCCACTGTGCTGG - Intronic
1037721300 8:21446656-21446678 TTGAGCGATCCCCAGCCTGCAGG + Intergenic
1039454522 8:37698096-37698118 TGCAGCGCGCACGACCCTGCCGG + Exonic
1041769013 8:61453010-61453032 AGCAGCGAGCTGCTCCCTGCGGG - Intronic
1047974443 8:130115322-130115344 TGCTGGGATTTCCAGCCTGCTGG + Intronic
1049004631 8:139847042-139847064 TGCAGCCATCCCTGCCCTGCAGG + Intronic
1049800413 8:144515055-144515077 TCCAGGCATCTCCACGCTGCTGG - Exonic
1050945233 9:11509485-11509507 TGGCGCGATCTCCACCCCCCAGG - Intergenic
1057432899 9:95011269-95011291 TGCAGTGACCTCCACCTCGCGGG + Intronic
1058583696 9:106484904-106484926 TGCCGAGACCTCCACCCTGGTGG - Intergenic
1187247631 X:17567327-17567349 AGCAGCGATGTCCAGCCTCCTGG + Intronic
1189420512 X:40853259-40853281 TGCAGAGATCTCCTCTCTGCAGG + Intergenic
1190410071 X:50128133-50128155 TGCAGCCATCTCCACTCTAAGGG + Intergenic
1194556376 X:95365508-95365530 TGAAGAGATTTCCCCCCTGCAGG - Intergenic
1194592455 X:95815929-95815951 TGCAGGGATCTCCAACCCCCGGG - Intergenic
1196889340 X:120277029-120277051 ACCAGTGATCTCCACCCGGCTGG + Exonic