ID: 1022092466

View in Genome Browser
Species Human (GRCh38)
Location 7:27116501-27116523
Sequence GACTCACTTTAGCACTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022092464_1022092466 16 Left 1022092464 7:27116462-27116484 CCTTTTTTGATATCTAATAGTTT 0: 1
1: 0
2: 2
3: 34
4: 551
Right 1022092466 7:27116501-27116523 GACTCACTTTAGCACTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022092466 Original CRISPR GACTCACTTTAGCACTTTCA TGG Intronic
No off target data available for this crispr