ID: 1022093833

View in Genome Browser
Species Human (GRCh38)
Location 7:27125666-27125688
Sequence GTTTAGGGATGCAGAGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022093829_1022093833 2 Left 1022093829 7:27125641-27125663 CCTGTGTTCTGCTATACAAGACT 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1022093833 7:27125666-27125688 GTTTAGGGATGCAGAGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022093833 Original CRISPR GTTTAGGGATGCAGAGACCA GGG Intronic
No off target data available for this crispr