ID: 1022095337

View in Genome Browser
Species Human (GRCh38)
Location 7:27137246-27137268
Sequence CAGGGGAAAGAGCAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1840
Summary {0: 1, 1: 1, 2: 25, 3: 188, 4: 1625}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022095334_1022095337 -8 Left 1022095334 7:27137231-27137253 CCGCCAACAATGAAGCAGGGGAA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG 0: 1
1: 1
2: 25
3: 188
4: 1625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022095337 Original CRISPR CAGGGGAAAGAGCAGGAGAA AGG Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900151496 1:1181012-1181034 CAGGGGCAAGGGCAGGGGCAGGG - Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900411087 1:2513020-2513042 CAGGTGAAGCAGCGGGAGAATGG - Exonic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900878297 1:5361897-5361919 GAGGGGAAAGGGGAAGAGAAAGG - Intergenic
901064864 1:6489832-6489854 CCGGCTAAAGGGCAGGAGAATGG + Intronic
901387744 1:8922146-8922168 AAGGGGACAGAGCTGGAGCAGGG - Intergenic
901590886 1:10341449-10341471 CTGAGGAGAGAGCAGGTGAAAGG + Intronic
901623054 1:10604673-10604695 CAGAGGAAATGGCTGGAGAAAGG + Intronic
901736647 1:11316742-11316764 CAGGGGCAAGAGAAGGAGAGAGG - Intergenic
901831462 1:11894816-11894838 CAAGGGCCAGACCAGGAGAAAGG + Intergenic
901920308 1:12531524-12531546 AGGGGGACAGAGCTGGAGAAGGG - Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902101372 1:13992687-13992709 GAAGGTAAAGAGCAGGGGAACGG + Intergenic
902113182 1:14099959-14099981 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
902221933 1:14971907-14971929 CAGGGGAAGGAGGACGAGACTGG - Intronic
902776715 1:18679489-18679511 GAGGGGAAAGAGCAGCAGCTGGG - Intronic
902919062 1:19655880-19655902 CAGGGAAAAGAACAGGTGCAAGG - Intronic
903049079 1:20587640-20587662 CAGGGGGAAAGGCAGGGGAAAGG - Intergenic
903880164 1:26502731-26502753 CAGGAGAATGAGATGGAGAAAGG - Intergenic
904321239 1:29698896-29698918 CAGGGGCAGGGGCAGGAGCAGGG - Intergenic
904322344 1:29706099-29706121 CAGGGGAAAGATGATGGGAAGGG - Intergenic
904324437 1:29718881-29718903 CAGAGGAAGGAGCAAGAGAGAGG + Intergenic
904376832 1:30086840-30086862 CAGGGGAAAGACGATGAGAAGGG + Intergenic
904698106 1:32341846-32341868 CAGGGGAAGGGGGAGGGGAAGGG - Intergenic
904719729 1:32499086-32499108 CTGAGGAATGGGCAGGAGAAAGG - Intronic
905013786 1:34763479-34763501 CAGAGGAAATAGCATGACAAAGG - Exonic
905313071 1:37064085-37064107 CAGGGAAGAGAGGAGCAGAAGGG + Intergenic
905651929 1:39662375-39662397 CAGGCTAGGGAGCAGGAGAATGG - Intronic
905677359 1:39836791-39836813 CTAGGTAAAGAGCAGGGGAAAGG + Intergenic
905714298 1:40134869-40134891 AAGGAGACAGAGAAGGAGAAGGG - Intergenic
905851768 1:41280036-41280058 CAGGGGCATCTGCAGGAGAAGGG - Intergenic
906025301 1:42668416-42668438 AATGGGAAAGAGAAGAAGAAAGG - Intronic
906180854 1:43817625-43817647 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
906244222 1:44261934-44261956 CTGCTGAAAGAGCAGGAAAAGGG - Intronic
906276025 1:44516642-44516664 GAAGGGAAAGAGGAAGAGAAGGG + Intronic
906459005 1:46023202-46023224 CAAGGGAAAAGGCAGGAGACAGG - Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906724668 1:48035578-48035600 CAAAGGAAAGAGCAGGGGGAGGG + Intergenic
906816490 1:48885627-48885649 CAAGAGAAACAGCAGAAGAAAGG - Intronic
906821180 1:48931922-48931944 CAGGGAGAAGAGCACCAGAATGG - Intronic
906859304 1:49341877-49341899 AAGGAGAGAGAGGAGGAGAAAGG - Intronic
907303523 1:53502176-53502198 CAGGGGAGAGAGGAGAAGAGAGG + Intergenic
907459591 1:54597449-54597471 CAAGGGGAGGAGGAGGAGAAAGG - Intronic
907621294 1:55983461-55983483 AAGGGGAAGGGGCAGGGGAAGGG + Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908030210 1:59991043-59991065 CAGGGGAAAGAGAACAAGATGGG + Intronic
908262568 1:62350139-62350161 GAGGGGAAAGGGAAGGGGAAAGG + Intergenic
908306149 1:62819281-62819303 CTGGGAAAAAAGCAGGAGATTGG + Exonic
908330718 1:63068217-63068239 AAGGGGGAAGGGGAGGAGAAAGG - Intergenic
908349153 1:63267066-63267088 GAGGAGGAAGAGGAGGAGAAGGG + Intergenic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908812890 1:68002011-68002033 GAGGAGAAGGAGGAGGAGAAAGG - Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
908868892 1:68584862-68584884 CTTGATAAAGAGCAGGAGAAAGG - Intergenic
909237372 1:73170858-73170880 CAGGTGAAAGAACATTAGAATGG - Intergenic
909307734 1:74102676-74102698 AAAGGGAAAGAGTAAGAGAAAGG - Intronic
909349182 1:74629602-74629624 CAGGAAAATGACCAGGAGAATGG - Intronic
909685181 1:78339817-78339839 CAGGAGAAAGAGCTAGAGCAAGG + Intronic
909736692 1:78970744-78970766 GAGAGGACAGAGGAGGAGAAAGG - Intronic
909813653 1:79962762-79962784 AAAGGAAAAGAGAAGGAGAAAGG + Intergenic
910018353 1:82554391-82554413 GAGGGTGGAGAGCAGGAGAAGGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910262720 1:85307651-85307673 CAGAGGACAGAGGAGGAGAGAGG - Intergenic
910288854 1:85581084-85581106 CAGGGGAAGGGGCTGGAGAGCGG - Intronic
910326489 1:86013960-86013982 AAGGGGACTGTGCAGGAGAAAGG - Intronic
910440099 1:87242995-87243017 AAGAGGAAAGGGCAGGACAAGGG - Intergenic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
910668994 1:89754132-89754154 TAGAGGACAGAGAAGGAGAATGG - Intronic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
910727233 1:90351781-90351803 ATGGGGAAAGAGCAGAAAAAAGG + Intergenic
910799771 1:91133422-91133444 CAGGAGAAAAAGGAGGGGAAAGG - Intergenic
910826445 1:91413118-91413140 TTGTGGAAAGAGCAGGAGACTGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911131522 1:94393280-94393302 GAAGAGAAAGAGGAGGAGAAAGG + Intergenic
911300606 1:96168498-96168520 GATGGGAAAGAGCAGGTGACGGG - Intergenic
911429545 1:97766611-97766633 CAGGGGAAAGGAAAGGGGAAGGG + Intronic
911509237 1:98791149-98791171 CAGCAGAAAGAGGAGGAGAGGGG + Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911824148 1:102460209-102460231 CAGAGGAAAGAGATAGAGAAAGG - Intergenic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
912746351 1:112248615-112248637 CAGAGGCATGAGCTGGAGAAGGG + Intergenic
913044143 1:115059123-115059145 CAGGGGAAAGGGTAGGAGTGAGG + Intronic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913509688 1:119550450-119550472 CAGGAGAAAGAGAAGGCGCACGG + Intergenic
914259954 1:145990484-145990506 CAGGCCAGAGAGCAGGACAAAGG - Intergenic
914677159 1:149914091-149914113 CAGGGGAATGGGAAGGGGAAGGG + Exonic
915004423 1:152623298-152623320 CAGGGGAGAGGGCCGGAGGAAGG - Intergenic
915306599 1:154983362-154983384 CAAGGGAAAGAGCCGGTGAAGGG + Exonic
915596688 1:156900325-156900347 CAGGGGATTGGACAGGAGAAGGG - Intronic
915601538 1:156925609-156925631 TATGGGAAGGAGCAGGAGCAAGG + Intronic
915656514 1:157365359-157365381 GAGAGGACAGAGAAGGAGAAAGG + Intergenic
915672772 1:157504212-157504234 GAGAGGACAGAGAAGGAGAAAGG - Intergenic
915730783 1:158052679-158052701 CAGAGGATAAGGCAGGAGAATGG + Intronic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
915981773 1:160424841-160424863 CAGGGAGAAGAGCAGCAGATGGG + Intronic
916126882 1:161579625-161579647 GAGGGGAAAGAGGAAGAGTATGG - Intergenic
916136801 1:161661429-161661451 GAGGGGAAAGAGGAAGAGTATGG - Intronic
916273250 1:162966861-162966883 CGGGGGAAAGAGTAGAAGCAAGG + Intergenic
916287900 1:163131229-163131251 CAGGAGAAAGAGAGAGAGAAGGG - Intronic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916536992 1:165712667-165712689 CAGGGGAAAAACCACCAGAAAGG + Intergenic
916820543 1:168393978-168394000 CAGGGGAGAAAAAAGGAGAATGG + Intergenic
917079726 1:171245132-171245154 TAGGGGAAAGGGCAGGAGGGAGG + Intergenic
917165684 1:172110124-172110146 CAGGGGCAAGAGAAGGAACAGGG - Intronic
917225576 1:172778141-172778163 CTGGGGAGAGAAGAGGAGAAGGG - Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917557087 1:176101427-176101449 GAGAGGACAGAGGAGGAGAAAGG - Intronic
917751366 1:178056512-178056534 AAGGGTTAAGAGCAGGGGAATGG + Intergenic
917968542 1:180193467-180193489 GAGGGGTAAAAGCAGGAGATTGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918157247 1:181860430-181860452 CAGGTGAAAAAGAAGGGGAATGG + Intergenic
918407169 1:184222724-184222746 GGGGCAAAAGAGCAGGAGAAAGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918790704 1:188823555-188823577 CAGAGGGCAAAGCAGGAGAATGG - Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919592635 1:199523605-199523627 CAGGGGAAAGGGTAGGAGGGAGG - Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919732453 1:200921940-200921962 GAGAGGTCAGAGCAGGAGAAAGG - Intergenic
919849774 1:201664840-201664862 CAGGGGAAAAGGGAGGAGATGGG - Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920116319 1:203624380-203624402 AAGGGGAAAGAAAGGGAGAAAGG + Intergenic
920122723 1:203670852-203670874 GAGGAGAGAGGGCAGGAGAAGGG - Intronic
920360875 1:205415270-205415292 GAAGGGAAAGAGAAGGAAAAGGG + Intronic
920398187 1:205661286-205661308 AAGGGGAAGGGGAAGGAGAAAGG + Intronic
920420150 1:205827696-205827718 CAAGGGAAAGTGGAGGAGGAGGG - Intergenic
920805039 1:209224968-209224990 AAAGGGAAAGAGAAGGAGAATGG - Intergenic
920816689 1:209341085-209341107 CAGGGGAAAGTAAGGGAGAAAGG - Intergenic
920823675 1:209404316-209404338 AAGGGGAGAGAGGAGCAGAAAGG + Intergenic
920963291 1:210682592-210682614 CAAGGGTAAGAGCTGGAGAGGGG - Exonic
920997085 1:211003647-211003669 AAGGAGGAAGAGGAGGAGAAAGG + Intronic
921572773 1:216798462-216798484 CAAGGGAAAGAGGATGAAAAAGG + Intronic
921687026 1:218101735-218101757 CAGGGGAAGGAAAAGGAGAAAGG + Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922204666 1:223436053-223436075 AAGAGGAAAAAGCAGGAGAAGGG + Intergenic
922361642 1:224828162-224828184 CAGGGGAAAGATCTGAAGCAGGG + Intergenic
922604207 1:226879175-226879197 CAGGTGGAAATGCAGGAGAAGGG - Intronic
922747340 1:228051847-228051869 CATGGGCCAGAGCAGGAGCAAGG + Intronic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922869583 1:228891305-228891327 GCAGGGAAAGAGCAGGTGAAAGG + Intergenic
923009558 1:230077290-230077312 CAGGGGATGGGGCAGGACAAGGG - Intronic
923051323 1:230393097-230393119 AAGGGGAAAAAGAAGGGGAAGGG + Intronic
923072416 1:230577841-230577863 AAGGGGAAGGGGGAGGAGAAGGG - Intergenic
923133024 1:231093708-231093730 CAGGGCAGAGGGCAGCAGAACGG - Intergenic
923143323 1:231179911-231179933 CTGGGCAAAGAGTAGGAGAAGGG + Intronic
923186175 1:231575740-231575762 CAGGAGAAAGACCAAGAGTATGG - Intronic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923660688 1:235954664-235954686 AAGGGGCAATAACAGGAGAAGGG + Intergenic
924350001 1:243105707-243105729 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
924494690 1:244575686-244575708 CAAGGGAAAGACCAGCAGAGAGG - Intronic
924494697 1:244575738-244575760 TAGGGGAAAGGGAAGGAGAGGGG - Intronic
924680008 1:246221452-246221474 GTGGGCAAAGAGAAGGAGAAAGG + Intronic
1062767174 10:74696-74718 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1063005541 10:1966940-1966962 CACGGGAAGGAGCAGGGGAGTGG + Intergenic
1063286249 10:4692074-4692096 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1063286251 10:4692080-4692102 AAGGGGAAGGAGAAGGGGAACGG + Intergenic
1063821282 10:9839269-9839291 CAGGGGAAAGGGCAAGAGTGGGG + Intergenic
1064121741 10:12624958-12624980 AAGGAGGAAGAGAAGGAGAAGGG - Intronic
1064156590 10:12907887-12907909 CCTGGGTAAGTGCAGGAGAAGGG + Intronic
1064263839 10:13808675-13808697 CAGGGGAAAGGGCAGGTGTCAGG - Intronic
1064283287 10:13970309-13970331 CAGGTGAAGAAGCAGGAGCAGGG + Intronic
1064305127 10:14158639-14158661 GAGGAGAAGGAGGAGGAGAAGGG + Intronic
1064322382 10:14317708-14317730 GAGGGGAGAGGGAAGGAGAAAGG + Intronic
1064420776 10:15188951-15188973 CAGGAGGAGGAGCTGGAGAATGG - Intergenic
1064533029 10:16329551-16329573 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
1064555599 10:16544307-16544329 CAGTGGAAAGAGCAGGGGTGGGG - Intergenic
1064715667 10:18174213-18174235 AAGGGGAAGGGGAAGGAGAAAGG - Intronic
1065223985 10:23524236-23524258 CAGGGGCAAGAGCAGGGGTGGGG + Intergenic
1065259773 10:23912478-23912500 AAGGGGAAAAAGTAGGAGAGGGG - Intronic
1065310331 10:24409740-24409762 CAGGGGAAAGGGTGGGAGAGGGG - Intronic
1065611252 10:27472721-27472743 CAGGTGCAAGAGCAGAAGTAGGG + Intergenic
1065638289 10:27753194-27753216 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638307 10:27753272-27753294 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065890766 10:30119241-30119263 CAGGGGAAAAGGCAGGAGGGAGG + Intergenic
1066179287 10:32944073-32944095 CAGGGGAAAAAGCAAAAGAGAGG + Intronic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066237689 10:33502305-33502327 CAGGGGAGAAAGCAGCTGAACGG - Intergenic
1066334512 10:34462865-34462887 AAGAGGAAAGAGAAGGGGAAGGG + Intronic
1066334606 10:34463130-34463152 AAAGGGAAAGAGAAGGGGAAGGG + Intronic
1066334664 10:34463301-34463323 GAGGGGAAAGGGAAGGGGAAAGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066431610 10:35357166-35357188 CAGGGGCAGGGGCAGGAGCAGGG - Intronic
1066466008 10:35650903-35650925 TGGGGAAAAGAGGAGGAGAAAGG - Intergenic
1066710740 10:38230877-38230899 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
1066753367 10:38683435-38683457 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1066979275 10:42396623-42396645 GAGAGGACAGAGGAGGAGAAAGG + Intergenic
1067024841 10:42836080-42836102 CAGGGGCCAGAGCAGCAGCAAGG - Intergenic
1067133040 10:43583576-43583598 CAGAAGAGAAAGCAGGAGAATGG + Intergenic
1067286310 10:44909995-44910017 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1067437280 10:46287129-46287151 CTGGTGAAAGGGCAGGAGGAGGG + Exonic
1067522541 10:47019223-47019245 CTGGGGAAAAAGAAGGAGATTGG + Intergenic
1067798796 10:49342213-49342235 CAGGAGAAGGAGCAATAGAAAGG + Intergenic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1068326908 10:55502322-55502344 CTGGGCAAAGAGGATGAGAAGGG - Intronic
1068421165 10:56795372-56795394 CATGGGAGTGAGCAGGAGAGAGG - Intergenic
1068935516 10:62632217-62632239 CAGTGGAAAGAGCAGGGGCTGGG - Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1070383755 10:75904981-75905003 GAGGGGAGAGAGGGGGAGAAAGG + Intronic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070586345 10:77769735-77769757 AAGTGGAAAGAGCAGGAGCCAGG - Intergenic
1070630775 10:78082826-78082848 CAGCCCAAAGAGCAGGAGAGAGG + Intergenic
1070772009 10:79088106-79088128 CAGGGGAAAGGGCAAAAGAAGGG - Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071472216 10:85991687-85991709 GAGGGGAAAGAGCAGAAAATTGG + Intronic
1071877757 10:89861295-89861317 AAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1071877761 10:89861320-89861342 GAGGGGGAAGAGGAGGAGTAGGG - Intergenic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1071889944 10:89993479-89993501 CAGGGGAAAGGGTGGGAGAATGG - Intergenic
1072000765 10:91193573-91193595 CAGGGGGATGAGTAGGAGATAGG + Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072102482 10:92242212-92242234 CAGGGGAATGAGGAATAGAAGGG - Intronic
1072276587 10:93829284-93829306 AAGGGGAAAGAGAAAGAGAGTGG - Intergenic
1072295882 10:94009228-94009250 CAGGGGCAAGAGACAGAGAAGGG + Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072563592 10:96599127-96599149 CAGCTGAAAGAGCAGCAGAACGG + Intronic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072645495 10:97251194-97251216 AAGGGGAAAGGGAAGGGGAAGGG + Intronic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1072896076 10:99367938-99367960 GTGGGGAAAGAGAAGGACAATGG + Intronic
1073091132 10:100940773-100940795 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1073117950 10:101102856-101102878 CAGGAGGCTGAGCAGGAGAATGG - Intronic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073374656 10:103022866-103022888 CAAGAGAGAGAGCAAGAGAAAGG + Intronic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1073703244 10:105954154-105954176 CAAAGGAAAGAACAGGAGGAAGG + Intergenic
1073988845 10:109240669-109240691 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
1074181521 10:111069211-111069233 AAGAGAAAAGAGCTGGAGAAGGG - Intergenic
1074191741 10:111144082-111144104 TTGGGGAAAGGGCAGGAGAGAGG - Intergenic
1074354670 10:112771427-112771449 CTGGGGAGGGAACAGGAGAAAGG + Intronic
1074382700 10:112993180-112993202 CAGGGGCAGGACCTGGAGAATGG + Intronic
1074483374 10:113849359-113849381 TAGGGGAAAGTGCATTAGAAGGG - Exonic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074630250 10:115246511-115246533 CAGGAGAAAGAAAAGGATAATGG + Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075180633 10:120207659-120207681 AAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075465319 10:122646615-122646637 CAGGGGAAACCCCAGGACAAGGG + Intergenic
1075597042 10:123739650-123739672 CTGGGGCAAGAGCAAGAGAGGGG - Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075680808 10:124329952-124329974 CAGGGGATGGAGAAGAAGAATGG - Intergenic
1075709048 10:124521045-124521067 AAGGGGACAGTGCAGGAGGAGGG - Intronic
1075795715 10:125118185-125118207 AAGCTGAAAGAGCAGGGGAATGG - Intronic
1075802342 10:125160925-125160947 CCGGGGAAGGAGAAGGAAAACGG + Intronic
1076202476 10:128569483-128569505 CTGGGGAAGGAGGAGGAGAGAGG + Intergenic
1076215498 10:128690106-128690128 ATGGGGAAAGGGCAGGAGACAGG - Intergenic
1076252348 10:128994583-128994605 CAGGGGGAGGTGGAGGAGAAAGG + Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076682390 10:132179895-132179917 CAGGGGGAAGAGCATGGGAGGGG - Intronic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1077235844 11:1481703-1481725 CAGGGGCAGGAGCAGGGGCAGGG + Intronic
1077398201 11:2336992-2337014 TAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1077554895 11:3221159-3221181 GAGGGGAGGGAGAAGGAGAATGG + Intergenic
1077791677 11:5447735-5447757 CTGGGGAAAGAGCCACAGAAAGG - Intronic
1078096788 11:8302440-8302462 GAGGGGAGAGAGAAGAAGAAAGG + Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078696111 11:13633721-13633743 CAGGAGAAAGAGCAAGAGTGGGG + Intergenic
1078914717 11:15768674-15768696 AAGAGGAAAGAGCAGGACAAAGG - Intergenic
1079016201 11:16870804-16870826 CAGAAGATATAGCAGGAGAAAGG + Intronic
1079234965 11:18681640-18681662 CTGGGGATTGCGCAGGAGAATGG - Intergenic
1079309002 11:19347950-19347972 CAGGAGAAAGAGGAGAAGCAAGG - Intergenic
1079549769 11:21680431-21680453 AAGGGTAAAGAAGAGGAGAAAGG + Intergenic
1079583509 11:22096074-22096096 GAGGGGAAAGAGTAGAAGATGGG + Intergenic
1079873027 11:25823242-25823264 CAGGAGCAAGAGCAAGAGAGTGG - Intergenic
1080091315 11:28352618-28352640 CAGGGTAAGGAGCAGGAATAAGG - Intergenic
1080157406 11:29127913-29127935 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
1080597975 11:33792486-33792508 CAGAGGAAAGAGAACGTGAAAGG + Intergenic
1080862956 11:36166104-36166126 CAGCGGAAAGAGCAGGAACCAGG - Intronic
1080930454 11:36804815-36804837 CTGGGGAAAGAGTCTGAGAAAGG + Intergenic
1081087454 11:38819427-38819449 AAGGGGAAAGAGCTGTAGCAAGG - Intergenic
1081155475 11:39684421-39684443 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1081305645 11:41508755-41508777 CAGGGAGAAGAGCACGAGAAAGG + Intergenic
1081462105 11:43281426-43281448 CAAGGGATAGAGCAGGAGGCAGG - Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081720451 11:45285243-45285265 CATTGTAAAGAGCAGCAGAAGGG - Intronic
1081826438 11:46058170-46058192 TGGGGGTAAGAGAAGGAGAAAGG + Intronic
1081831060 11:46114813-46114835 GAGGAGAAGGAGCAGCAGAAAGG - Intronic
1082162419 11:48900303-48900325 CAGGCCAAGGTGCAGGAGAAGGG - Intergenic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1082827148 11:57588228-57588250 CAGGAGAGAGAGCAAGTGAAAGG - Intergenic
1082892424 11:58154177-58154199 GAGGGGAAGGAGGAGGAGAAGGG + Intronic
1083022550 11:59521698-59521720 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1083424412 11:62575683-62575705 GAGGGGAAAGAGGAGCAGCAGGG - Exonic
1083487130 11:62990284-62990306 AAGAGGAAAGAGAATGAGAAGGG - Intronic
1083887495 11:65580050-65580072 CAGGGGAGAGACCAGGAGAAGGG - Intronic
1084014200 11:66369139-66369161 CAGGGCAAAGAGCAGCAGTATGG + Exonic
1084554174 11:69865864-69865886 CAGGAGAAATGGCAGGAGTAGGG + Intergenic
1084972693 11:72780476-72780498 GAAGGGAAAGAGCAAGAGCAGGG + Intronic
1085310589 11:75514292-75514314 GAGGGGGAGAAGCAGGAGAAGGG + Intronic
1085324888 11:75598956-75598978 CAGGTGGAGAAGCAGGAGAAGGG + Intronic
1085777276 11:79378295-79378317 CAGGATAAAGAGCCAGAGAAGGG - Intronic
1086134976 11:83436043-83436065 CAGAGCAAAGAGCAGGACAGGGG + Intergenic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086558656 11:88141778-88141800 CAGAGGAAACAGCACGTGAAAGG - Intronic
1086595899 11:88570035-88570057 CAAAGGAAAGAGAAGGGGAAGGG + Intronic
1086863066 11:91947888-91947910 TAAGGGGAAGAGGAGGAGAAAGG - Intergenic
1087073473 11:94105329-94105351 TAGGGGAAAGAGTAGCTGAATGG - Intronic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087122498 11:94589594-94589616 CAGGGAAGGGAGCAGGGGAATGG - Intronic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1087230241 11:95653048-95653070 CAGGGGAATGGGGAGGAGAGTGG + Intergenic
1087261780 11:96020238-96020260 GAGGGGAAAAAGCAGCAAAAGGG - Intronic
1087388210 11:97500795-97500817 CAGTGGAATGAGCAAGAAAATGG - Intergenic
1087701348 11:101440041-101440063 ATGGGGAAAGAGTGGGAGAAAGG + Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088181534 11:107118213-107118235 CAGGAAAGAGAGCAAGAGAAGGG - Intergenic
1088347844 11:108849187-108849209 CAAGAGAAAGATCATGAGAATGG - Intronic
1088573959 11:111251724-111251746 CATGTGAAAGAGCAGGGGAGGGG - Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089111742 11:116062723-116062745 CAGGGGAGAGAGGAGGAAACGGG + Intergenic
1089165824 11:116475698-116475720 AAGGGGTAAGAGCAGAAGCAGGG + Intergenic
1089559588 11:119337109-119337131 CAGGGGAAAGAGCAGAAATCCGG - Exonic
1089701401 11:120246219-120246241 CCGGGGAAAGGGGAAGAGAAAGG + Intronic
1089704309 11:120266385-120266407 CAGGGGTAAGAGAAGAGGAAGGG - Intronic
1089741239 11:120586043-120586065 CAGAGGTAAGAGCTGGAGATAGG + Intronic
1089776451 11:120840192-120840214 GAGGGGAGAGAGCAGCAGACAGG + Intronic
1090098749 11:123771572-123771594 CATGGGAATGAGAAGGAGAAAGG - Intergenic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090564352 11:127970900-127970922 CTAGGGAAAGAGCACAAGAAAGG + Intergenic
1090631154 11:128649820-128649842 AATGAGAAAGAGGAGGAGAAGGG + Intergenic
1090753576 11:129768741-129768763 CTGGGGAAAGAACAGCAGAGAGG + Intergenic
1090845629 11:130527769-130527791 AAGGGGAGAGAGGAAGAGAAAGG - Intergenic
1090857940 11:130627075-130627097 CAAGGGAAAAAGAAGGACAAAGG + Intergenic
1091069089 11:132546427-132546449 CGGGGGAAAGGGTGGGAGAAGGG - Intronic
1091070616 11:132559167-132559189 GAGGGGAAAGAGAGGGAGAGAGG + Intronic
1091192478 11:133706998-133707020 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
1091192573 11:133707356-133707378 AAGGGGAAAGAGAAGGGGAAAGG + Intergenic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1091896482 12:4109284-4109306 AAGGAGGAAGAGGAGGAGAATGG + Intergenic
1091900616 12:4141183-4141205 CAGGTGAAAGAGCAGGAAACGGG + Intergenic
1091941913 12:4493229-4493251 CAGAGGAATGGGCAGAAGAATGG + Intronic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1092253657 12:6915058-6915080 CGTGGGGAAGAGCAGGAGAGAGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092488925 12:8927049-8927071 AATGGGAAAGAGCAGCAGATAGG + Intronic
1092874006 12:12832555-12832577 CAAGGGAAAGGAAAGGAGAAAGG + Intergenic
1093017644 12:14170961-14170983 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1093040995 12:14379235-14379257 CAGAGGCAAGAACAAGAGAAAGG - Intronic
1093209373 12:16289340-16289362 AAGGGAACAGACCAGGAGAAAGG + Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094156086 12:27338221-27338243 AAGTGGATAAAGCAGGAGAAGGG + Intronic
1094555751 12:31497918-31497940 CAGGGGCAAGGGCAGGGGGAGGG + Intronic
1094676698 12:32627516-32627538 AAGGGGAAGGAGGAGGAGATGGG + Intronic
1094691315 12:32772067-32772089 GAGGGGAAAGGGAAAGAGAAAGG + Intergenic
1094788078 12:33874486-33874508 GAGGAGAAAGAGTAGAAGAATGG - Intergenic
1095323971 12:40864490-40864512 CAGGGGTAAGAGGAGGGGATGGG - Intronic
1095762247 12:45852605-45852627 CAGATGATAGGGCAGGAGAATGG - Exonic
1095999719 12:48119202-48119224 GAGGAGGAAGAGGAGGAGAAAGG + Intronic
1096208315 12:49741922-49741944 GAGGAGAAGGAGCGGGAGAAAGG - Exonic
1096228369 12:49883492-49883514 CAGGGGAAGGGGCAGGAGCTTGG + Intronic
1096402604 12:51319620-51319642 AAGGAGAAAGAGCAAGAGCAAGG + Intronic
1096587976 12:52636127-52636149 CAGGGGAAAGAAGAGAAGGAGGG - Intergenic
1096678948 12:53242151-53242173 CGGGGGCAAGAGCAGGTGCAGGG - Intergenic
1096737242 12:53665317-53665339 CATGGCAAAGAGGATGAGAAAGG + Exonic
1096837194 12:54358436-54358458 AATGGGAAAGACCAGGAGGAAGG - Intergenic
1097045377 12:56183931-56183953 CTGGGGATAGAGGAAGAGAAGGG + Intronic
1097137323 12:56869476-56869498 CAGGAGAAAGTGAAGGATAAAGG + Intergenic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1097426633 12:59453787-59453809 CAGGAGAAAGAGCAGGAATAAGG + Intergenic
1097607577 12:61774663-61774685 CGGGGGAAAGAGTGGGAGGATGG + Intronic
1098081508 12:66790887-66790909 AAGGGGAAGGAGCGGGAGGAAGG + Intronic
1098177853 12:67811702-67811724 CAGGAGAAAGACAATGAGAATGG + Intergenic
1098303235 12:69075819-69075841 CAGGGGGAAGAGGAGGATAATGG + Intergenic
1098464950 12:70776025-70776047 CAGGTGTAAGACCATGAGAAAGG - Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099111258 12:78564459-78564481 CAGGGCAAACACCAGGAGAGTGG + Intergenic
1099258995 12:80352639-80352661 CAGGGAAAAGAGAAAGGGAAGGG - Intronic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100029843 12:90173130-90173152 GAGAGGAAAGAACAGGAGAGAGG - Intergenic
1100343188 12:93701238-93701260 CAGGAGGAAGAGGAGGAGAAGGG - Intronic
1100588463 12:96001146-96001168 AAGGAGACAGAGGAGGAGAAAGG + Intronic
1100659652 12:96682958-96682980 CAAGGGAAAGACAAGGAAAATGG - Intronic
1100804521 12:98267579-98267601 GAGGGAAAAGAGCAAGAGAAAGG + Intergenic
1100833856 12:98546372-98546394 CAGAGGAAAGAAGAGTAGAAAGG + Intronic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101334178 12:103781644-103781666 AGGGGGACAGAGCTGGAGAAAGG - Intronic
1101395338 12:104342165-104342187 CTGGGGAGGGAGCAGGAGATTGG - Intronic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101489500 12:105198095-105198117 AAGTGGAAAGAGCAGCAGAAGGG + Intronic
1101580552 12:106037908-106037930 GAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1101762782 12:107672700-107672722 AAGGGGAAAGAGCAGAGAAAGGG + Intergenic
1101787787 12:107900836-107900858 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
1102005799 12:109588486-109588508 CAGGGGAACGGCCAGGGGAATGG + Intronic
1102015777 12:109646969-109646991 AAGGTGAAAGAGAAGGATAAAGG - Intergenic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1102853741 12:116276724-116276746 GGGGGGAAAGGGGAGGAGAAGGG + Intronic
1102942463 12:116955669-116955691 GAGGAGAAAGAGTAGAAGAAAGG + Intronic
1103037339 12:117667198-117667220 CAGGGGAAAGAGCAGGAACTGGG + Intronic
1103223443 12:119266247-119266269 AAGGAGGAAGAGGAGGAGAAAGG - Intergenic
1103502767 12:121416587-121416609 CAGGTCAAAGTTCAGGAGAAAGG - Intronic
1103560016 12:121788741-121788763 AAGGTGAAAGCCCAGGAGAAGGG + Intronic
1103567261 12:121823009-121823031 CAAGGGCAAGGGCAGGGGAAGGG - Exonic
1103568295 12:121828094-121828116 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1103912923 12:124362147-124362169 CCGGGGCAAGAGCAGGAGCCCGG - Exonic
1104483972 12:129133504-129133526 AAGGGGGAAGAGCAGGATAAAGG - Intronic
1104600412 12:130149659-130149681 CAGGGCCAGGAGCTGGAGAATGG + Intergenic
1104782775 12:131432515-131432537 CAGGAGGAGGAGGAGGAGAAGGG + Intergenic
1104846123 12:131847870-131847892 CAGGGGACAGAGGGGGAGCAGGG - Intronic
1104926661 12:132317361-132317383 GAGTGGAAGGAGCAGGAGAGAGG - Intronic
1105518746 13:21113113-21113135 CCTGCAAAAGAGCAGGAGAAGGG - Intergenic
1105923371 13:24985071-24985093 CAGAAGATACAGCAGGAGAAGGG + Intergenic
1106189636 13:27439815-27439837 CAGGAGTAAGTGCAGGATAAAGG + Intronic
1106299927 13:28454088-28454110 CTGGGGAAAGAGCAGTAAGAGGG - Intronic
1106463424 13:29992281-29992303 CAGGAGCAAGAGAATGAGAAGGG - Intergenic
1106665043 13:31842890-31842912 CAGGAGAATGAGCAGGACAGTGG + Intergenic
1106771503 13:32965260-32965282 AAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1106859018 13:33884853-33884875 CAGAGGAAAGAAAAAGAGAAAGG + Intronic
1107230987 13:38110213-38110235 GAGGGTAAAGAGCGGGAGAAGGG + Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107795445 13:44046885-44046907 AAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1107795453 13:44046903-44046925 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1107795456 13:44046909-44046931 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107935577 13:45342676-45342698 CTTGGGAAAGAGCAGGACACAGG + Intergenic
1108391254 13:49950018-49950040 CAGGGGAAAGGGTGGGAGAGGGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108581714 13:51833686-51833708 CAGGGGAATGAACTGGAGTATGG + Intergenic
1108814548 13:54273898-54273920 AAGGGGAAAGAGGAGAAGAAAGG - Intergenic
1109617766 13:64859152-64859174 CAGGGGAAAGAGTGGGAGTAGGG - Intergenic
1109922169 13:69079257-69079279 GAGGAGAAAGAGTAGGAGAGAGG - Intergenic
1110228985 13:73148737-73148759 GAGGGGAAGGAGGTGGAGAAGGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110420290 13:75299881-75299903 CAGGAGAAATACCAGGAAAATGG + Intronic
1110515820 13:76411407-76411429 AAGGGGGAGGAGGAGGAGAAAGG + Intergenic
1110515889 13:76411554-76411576 GAGGGGGAGGAGGAGGAGAAGGG + Intergenic
1110583469 13:77159650-77159672 CAGGAGAGAGAGAAGGGGAAAGG - Intronic
1110743622 13:79027023-79027045 CAAAGGAAAGAGCAGAGGAATGG - Intergenic
1110781928 13:79476467-79476489 TAGAGGAAGGAACAGGAGAAAGG - Intergenic
1111294137 13:86257699-86257721 CAGGGGTAAGAGGCAGAGAAAGG - Intergenic
1111315640 13:86555296-86555318 CAGGGAAGAGAGCAGGATCAAGG + Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111643935 13:91006264-91006286 AAACGGAAAGAGCTGGAGAAGGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1111820090 13:93203134-93203156 CAGGGGAAAGAATGGGAGTAGGG - Intergenic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112112823 13:96321674-96321696 CAAGGGAAAGGGCAAGAGAGGGG - Intronic
1112393100 13:99003030-99003052 GAGGGGAAAGAAGAAGAGAATGG + Intronic
1112504990 13:99970186-99970208 CCGGGGAAAGGGCAGGGAAAGGG + Exonic
1112842894 13:103601407-103601429 CCCGGAAAAGAGCAGGAGCAAGG + Intergenic
1113360994 13:109631350-109631372 CTGGGGAAAGTGGAGCAGAATGG - Intergenic
1113375194 13:109758936-109758958 AAGGGGAAAGGGAAGGAGAAGGG + Intronic
1113603781 13:111590276-111590298 TAGGTGACAGAGCAGAAGAATGG + Intronic
1113681121 13:112245822-112245844 CAGTGGAAAGAGGAAGGGAAAGG + Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114407538 14:22470771-22470793 CAGGGACAAGAGCAGAAGCAAGG - Intergenic
1114412041 14:22509919-22509941 GAGGGGAAAGAGAAGGCTAAGGG + Intergenic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114525826 14:23366325-23366347 GAGGGGAAAGGGGAGGGGAAGGG + Intergenic
1114563734 14:23612549-23612571 GAGGGGAAAGTGCAGTAGGATGG + Intergenic
1114675439 14:24437100-24437122 CAGGGGAGAGAAGAGGAAAAAGG + Exonic
1114730841 14:24990961-24990983 AAGGAGAGAGAGCATGAGAAAGG + Intronic
1114901924 14:27072279-27072301 GAGGGGAGAGGGCAGGAGGAGGG + Intergenic
1115430158 14:33308079-33308101 CAGGGCCAAGGACAGGAGAATGG + Intronic
1115786979 14:36837323-36837345 CAGGAGAAGGAGGAGGTGAAGGG + Intronic
1115921492 14:38379244-38379266 CAGAGGAAACAGCAAGTGAATGG + Intergenic
1116312048 14:43340200-43340222 TAGGAGAAAGAGAAGAAGAAAGG + Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1116575959 14:46575559-46575581 CAAGGGCAAGAGCAAGACAAGGG + Intergenic
1116579254 14:46617798-46617820 CAGGAGAGAGAGCAAGTGAATGG + Intergenic
1116731508 14:48628388-48628410 GAGGGGAGAGAGGGGGAGAAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117314156 14:54557636-54557658 CAGTGGAAAGGCCTGGAGAAGGG + Intergenic
1117402488 14:55370942-55370964 GAGGGGAAAAAGAAGCAGAAAGG - Intronic
1117657845 14:57974600-57974622 CAGGGGACAGAGCTTCAGAATGG + Intronic
1117874817 14:60241102-60241124 ACGTGGAGAGAGCAGGAGAATGG + Intergenic
1118201672 14:63679870-63679892 CAGGAGGAAGAGAAGGTGAAGGG + Intergenic
1118279963 14:64419415-64419437 GTGGGGAGAGAGCAGGAGAGAGG + Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118723269 14:68609052-68609074 CAGGAGAAGGAACAGGTGAAGGG - Intronic
1118952283 14:70445825-70445847 CAGAGGACAGAGGAGGAAAAAGG + Intergenic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119180377 14:72601026-72601048 GAGGAGGAAGAGGAGGAGAAGGG + Intergenic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119276589 14:73362379-73362401 GAGGGAAAAGAGGAGGAAAAGGG + Intronic
1119296578 14:73537915-73537937 CAGTGGAAAGCGCAGGAACAGGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119542793 14:75451629-75451651 GATGGGAAATAGCAGGAGACTGG + Intronic
1119782802 14:77289057-77289079 CAGGTGAACAAGCAGGAGAAAGG + Intronic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120238784 14:81925311-81925333 CAGGGAAAAGCAGAGGAGAATGG - Intergenic
1120405428 14:84089095-84089117 AAGGTAAAAGAGCAGGACAAGGG + Intergenic
1120642354 14:87030440-87030462 CTGGGGAAAGGACAGGTGAAAGG - Intergenic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1120923170 14:89773204-89773226 AAGGGGAAAGAGCACGTGGAGGG + Intergenic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121068267 14:90990875-90990897 GAGGGGAGAGGGTAGGAGAAGGG + Intronic
1121170800 14:91852733-91852755 CAAGAGAAAGAGAAAGAGAAGGG + Intronic
1121170996 14:91854460-91854482 GAGGGGAAGGAGGAGGAGATAGG + Intronic
1121231975 14:92364961-92364983 CAGTGGAAAGGGCAGGGGCAAGG - Intronic
1121310340 14:92932336-92932358 GGTGGGCAAGAGCAGGAGAATGG - Intronic
1121408119 14:93731622-93731644 AATGGGGAAGAGAAGGAGAAAGG - Intronic
1121593267 14:95137174-95137196 AAGGGGAAGGAGAAGGAAAAGGG + Intronic
1121777260 14:96598892-96598914 CAGGGGAAAGTGGAGCAGCAGGG - Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122505778 14:102230847-102230869 TTGGGGAAAGATCAGGAGAAGGG + Intronic
1122578747 14:102757989-102758011 CTGGGGAAAGGGCAGGACAGAGG + Intergenic
1122879453 14:104683495-104683517 GAGGGGAGAGTGAAGGAGAAGGG + Intergenic
1123005830 14:105323358-105323380 CAGGGGGAAGGGCTGGAGACAGG - Intronic
1123125937 14:105946025-105946047 CAGGAGAAGGCCCAGGAGAAGGG + Intergenic
1123406520 15:20022443-20022465 CAGGAGAAGGCCCAGGAGAAGGG + Intergenic
1123515850 15:21029091-21029113 CAGGAGAAGGCCCAGGAGAAGGG + Intergenic
1123678642 15:22739478-22739500 AAGGGGGAAGGGAAGGAGAAAGG - Intergenic
1123736377 15:23188189-23188211 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124190147 15:27567647-27567669 CCGGGGAAAGGGCGGGAGGAGGG - Intergenic
1124287083 15:28411166-28411188 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124295618 15:28500463-28500485 AAGGGGAAAGCGAAGGAGAAAGG + Intergenic
1124679119 15:31714385-31714407 CAGGTGAGAGGTCAGGAGAATGG + Intronic
1124959676 15:34385019-34385041 CAGGGGACAGGGCAGGTGACTGG + Intronic
1124976302 15:34531240-34531262 CAGGGGACAGGGCAGGTGACTGG + Intronic
1125031441 15:35079620-35079642 CAAGAGAAAAAGGAGGAGAAAGG + Intergenic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125228478 15:37424544-37424566 CAGGGGAAAGGGCAGGAGAGGGG - Intergenic
1125264460 15:37863173-37863195 AAGGGGAAGGAGCTGGAAAAGGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125359367 15:38849520-38849542 CAGGGGAAATAGCAAGGTAAAGG + Intergenic
1125393829 15:39225736-39225758 GAAGGGTGAGAGCAGGAGAAAGG + Intergenic
1125521982 15:40353302-40353324 GAAGGGAGAGAGCAGGAGAGCGG + Intronic
1125766989 15:42142562-42142584 CAGGGGGAAGTGCAGCACAATGG + Exonic
1126108112 15:45160294-45160316 CATGGGAAGAACCAGGAGAAGGG + Intronic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126689028 15:51273546-51273568 CAGAGGAAAGAGCACTGGAATGG + Intronic
1126694027 15:51310813-51310835 CAGAGGAAAGAGGGGGAGAAAGG + Intronic
1126872997 15:53009764-53009786 TAGGGGAAAGAGCAGAAACATGG + Intergenic
1126969047 15:54089069-54089091 GAGGGGTAAGCACAGGAGAAGGG - Intronic
1127035154 15:54907809-54907831 CGGGAGGATGAGCAGGAGAATGG + Intergenic
1127314943 15:57785978-57786000 CAGGAGAAGGAGCAGGTGACGGG - Intergenic
1127315499 15:57790678-57790700 CAGGGTCAAGAGCAGGGGAATGG - Intergenic
1127747622 15:61996075-61996097 GCAGGGAAAGAGCTGGAGAAGGG + Intronic
1127767730 15:62203898-62203920 AAGGGGGAAGAGAAGGAGAGGGG - Intergenic
1127800835 15:62476208-62476230 CAGGTGACAAAGCAGGAGGAGGG - Intronic
1127999240 15:64175457-64175479 CAGGCAAGAGAGCAGGGGAAGGG + Intronic
1128186966 15:65650802-65650824 GAGGAGGAAGAGGAGGAGAAGGG + Exonic
1128313369 15:66645305-66645327 CAGGGGATAGAGCACAAGCACGG + Intronic
1128705125 15:69832605-69832627 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
1128772083 15:70290297-70290319 GATGGAAGAGAGCAGGAGAAGGG - Intergenic
1128867417 15:71125107-71125129 AAGGGGAAAGGGAAGGAGAAAGG + Intronic
1129350878 15:74955458-74955480 CAGGGGAAAGAAAACTAGAAAGG + Exonic
1129388404 15:75208208-75208230 CAGGGGATGGAGCTGGAGCAGGG - Exonic
1129497344 15:75997728-75997750 CAGGGCCAAGAGATGGAGAAGGG - Intronic
1129652262 15:77499471-77499493 CAGGGTAAAGAGCTGGGGAGAGG - Intergenic
1129671765 15:77611657-77611679 CAGGGGATAAAGCCTGAGAAAGG + Intergenic
1129695677 15:77739496-77739518 CAAGGGAAAAAGGAGGGGAAAGG - Intronic
1129905757 15:79186074-79186096 TAGGTGAAGGAGGAGGAGAAAGG + Intergenic
1130033896 15:80340958-80340980 CAGGAAACAGAGGAGGAGAAGGG + Intergenic
1130157106 15:81360620-81360642 CGGGGGAAAGAGCCAGGGAAGGG + Intronic
1130271687 15:82454170-82454192 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130464035 15:84181557-84181579 CAATGGAAAGAGCAGGAGAAGGG + Intronic
1130474836 15:84255487-84255509 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130482252 15:84369543-84369565 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130488649 15:84413276-84413298 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130500232 15:84491984-84492006 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130507787 15:84562463-84562485 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130552630 15:84900841-84900863 AAGGGGAAAGGGAAGGGGAAGGG + Intronic
1130586331 15:85186189-85186211 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130732155 15:86507602-86507624 GAGGGTAATGAGCAGGTGAAAGG + Intronic
1130755453 15:86758153-86758175 CAGGGGAAGGCACAGGAGAGTGG - Intronic
1130894380 15:88158969-88158991 CAAGGGATAGAGAGGGAGAAGGG + Intronic
1130963429 15:88680429-88680451 CATGGGAAGGGGCAGGATAATGG + Intergenic
1131017848 15:89072488-89072510 GAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1131035666 15:89220519-89220541 GAGTGGAAAGAGCAGGAAATGGG - Intronic
1131112988 15:89776895-89776917 CAGGGGCAAGGGCAGGGGCAGGG + Exonic
1131112998 15:89776919-89776941 CAGGGGCAAGGGCAGGGGCAAGG + Exonic
1131171476 15:90181903-90181925 GAGGAGAAGGAGCAGGAAAAGGG + Intronic
1131292029 15:91114758-91114780 TAGCTGAAAGAGCAGAAGAACGG + Intronic
1131407310 15:92175883-92175905 TAGGGGAAAGAGCAGGTAACAGG + Intergenic
1131485459 15:92816448-92816470 CAGGAGGCTGAGCAGGAGAATGG - Intergenic
1131947077 15:97635278-97635300 CAGGGGAAAGAGCATCTGAAAGG - Intergenic
1132142166 15:99405210-99405232 GAGAGGAAACATCAGGAGAAAGG + Intergenic
1132428119 15:101737776-101737798 CAATGGAAAGAGCAGGAGAAGGG - Intronic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132550831 16:553245-553267 CAGGGGCAGGAGCAGGAGTGGGG - Intronic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1133426876 16:5699936-5699958 CAGGAGGCTGAGCAGGAGAATGG - Intergenic
1133552055 16:6866105-6866127 CTGGGGAAAGAAAAGGAGAGGGG - Intronic
1134081025 16:11325083-11325105 CAGGGGGAAGAGCAGGCAGAAGG + Intronic
1134187860 16:12098618-12098640 CAGGCAAAAGAGGAGGAGAGGGG - Intronic
1134321236 16:13166308-13166330 CAGGCAAAAAAGCAAGAGAAAGG - Intronic
1134718963 16:16370596-16370618 AAGGGGAGAGAGATGGAGAAAGG - Intergenic
1134770608 16:16806056-16806078 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1135028157 16:19014599-19014621 CAGGGGAAAGAGAAGGTGCTGGG - Intronic
1135075097 16:19386424-19386446 CAGGAGAAGGAGGAGGAGAGAGG - Intergenic
1135124609 16:19798039-19798061 CAGGGGTAAGAGGCAGAGAAAGG + Intronic
1135175238 16:20221958-20221980 AAGAGGCAGGAGCAGGAGAAGGG - Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135186100 16:20317044-20317066 AAGGGGAAAGAGAACGGGAAGGG - Intronic
1135624395 16:23982055-23982077 GAAGGGAAAGAGAAGGGGAAGGG - Intronic
1135624507 16:23982354-23982376 CAAGGGAAAGGGAAGGGGAAGGG - Intronic
1135795971 16:25442858-25442880 AAGGGAAAGGAGAAGGAGAAGGG - Intergenic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1136729340 16:32393556-32393578 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
1137273814 16:46920251-46920273 AAGGGGAAAGAGCAGGAGTTTGG + Intronic
1137399651 16:48142958-48142980 CAGGGAGTAGAGCAGGAGCATGG + Intronic
1137871043 16:51950613-51950635 GAGGGAAAAGAGCATGAGAAGGG + Intergenic
1137978834 16:53053234-53053256 GAGGAGGAGGAGCAGGAGAAAGG - Intergenic
1138183274 16:54957630-54957652 GAGGAGGAAGAGGAGGAGAAGGG - Intergenic
1138199987 16:55081517-55081539 CAGGAGCAAGAGCAAGAGAAAGG + Intergenic
1138247553 16:55479028-55479050 CGGGGAAAAGAGGTGGAGAAAGG + Exonic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138446931 16:57070440-57070462 CAGGGGACAGAGCAGGAGAGGGG + Intronic
1138467543 16:57202776-57202798 CAGGAGAAAGAAAAGGATAAAGG - Intronic
1138518609 16:57555955-57555977 CAGGGGAGAGAGAGAGAGAAGGG - Intronic
1138579407 16:57930552-57930574 GAGGGGAAGGAGGAGGGGAAGGG + Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139392802 16:66615739-66615761 CAGGGGAAGGAGCCGGACACCGG + Exonic
1139918815 16:70445909-70445931 AAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1140052307 16:71492905-71492927 CAGGGGAAAGTGCAGGGCAGAGG + Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140209664 16:72960228-72960250 GAGGGGAAAGAGAGAGAGAAAGG + Intronic
1140357666 16:74320002-74320024 CAGAGAAGAGTGCAGGAGAAAGG - Intergenic
1140447103 16:75038536-75038558 CAAGGGGAAGGGCAGGAGAGGGG + Intronic
1140455100 16:75100388-75100410 TAGGGGAAAGGGAAGGGGAAGGG - Intronic
1140602236 16:76491129-76491151 GAGGAGAAAGAGGAGAAGAAGGG - Intronic
1140732453 16:77869120-77869142 CAGGAGAATGAGTAGCAGAAGGG + Intronic
1140862233 16:79028054-79028076 CGGGAGGCAGAGCAGGAGAATGG - Intronic
1141007139 16:80363142-80363164 GAGGAGAAAGAGGAGGGGAAGGG + Intergenic
1141036590 16:80631410-80631432 CAGGGTACATGGCAGGAGAAGGG - Intronic
1141155505 16:81594021-81594043 GAGGGGGAGGAGGAGGAGAAGGG - Intronic
1141244868 16:82296487-82296509 CAGGGGAAAGTGTGGGAGGAGGG - Intergenic
1141400678 16:83744514-83744536 CAGGGGACAGATGGGGAGAACGG - Intronic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142303729 16:89274207-89274229 CAGTGGACAGAGCAGGTCAAAGG + Intronic
1142395963 16:89831779-89831801 AAGGGGGAGGGGCAGGAGAAAGG - Intronic
1202997056 16_KI270728v1_random:123965-123987 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1203023743 16_KI270728v1_random:436307-436329 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1142599055 17:1044180-1044202 CAGGGGCAAGAGCCGGTGGAGGG + Intronic
1142614164 17:1125313-1125335 GAGGGGAATGAGGAGCAGAAGGG - Exonic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1142845248 17:2669752-2669774 AAGGGGAAAGGGAAGGGGAAGGG - Intronic
1143280919 17:5753517-5753539 CAGAGGAGAGAGCAGGGGAGAGG - Intergenic
1143343249 17:6230593-6230615 ATGGGGGAAGAACAGGAGAAGGG + Intergenic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143478906 17:7217612-7217634 AAGGGGAGAGAGGAGGAGAGAGG + Intronic
1143660935 17:8324293-8324315 CTGGGGAAAGAGCATTCGAATGG + Intergenic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144647488 17:16985284-16985306 ATGGTGGAAGAGCAGGAGAATGG - Intergenic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144746803 17:17621448-17621470 AAGGGGGAGGAGGAGGAGAAGGG + Intergenic
1144874796 17:18391836-18391858 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1144876844 17:18401589-18401611 CTGGGGAGATAGCAAGAGAAAGG - Intergenic
1145062891 17:19743695-19743717 CAGGGGAGAGAGCCGGTGAAGGG + Intronic
1145155386 17:20542829-20542851 CTGGGGAGATAGCAAGAGAAAGG + Intergenic
1145157429 17:20552585-20552607 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1145799841 17:27675932-27675954 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1145858306 17:28183984-28184006 CAGGGGACAGAGCAGGTAAATGG - Intronic
1145935594 17:28712905-28712927 CAGGATGAAGAGGAGGAGAAAGG + Intergenic
1146132868 17:30293539-30293561 CAAGTCAAAGAACAGGAGAAGGG + Intergenic
1146159363 17:30551666-30551688 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1146329063 17:31912458-31912480 CAGGGCAAAGTGCAGGAAAAAGG + Intergenic
1146370710 17:32264359-32264381 CAGGGGAACTGGAAGGAGAAGGG - Intergenic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146578749 17:34017355-34017377 CAGGGGAAAGGGGAAGAGATAGG - Intronic
1146667126 17:34712643-34712665 ATGAGGAAAGAGCAGCAGAAAGG - Intergenic
1146710496 17:35036899-35036921 AAGGGGAGAGAGGAGTAGAAGGG + Intronic
1146786242 17:35724460-35724482 CAGGGGAAAGGAAAGGAGTAAGG - Intronic
1146845216 17:36178148-36178170 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146873432 17:36389991-36390013 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146880791 17:36441079-36441101 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1146890855 17:36505668-36505690 GAGGGGAAAGAGGAGGAGATTGG - Intronic
1147065958 17:37922882-37922904 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1147219330 17:38919334-38919356 CAGGGGCAACAACAGGAGAATGG + Exonic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147538138 17:41334188-41334210 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147847002 17:43411582-43411604 AAGGAGAAAGAGCAAGAGAAGGG - Intergenic
1147890048 17:43710781-43710803 AAGGGCAAAGAGAGGGAGAAAGG + Intergenic
1147959248 17:44156157-44156179 AAGGGGAAAGATGAGGAAAATGG - Intronic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148232840 17:45947777-45947799 AAGGGGAAAGACGAGGACAAAGG - Intronic
1148431164 17:47644891-47644913 AAGGGGAAAGAGCAGATGCAGGG - Intergenic
1148476134 17:47929885-47929907 AAGGGAACAGAGCAGGGGAATGG - Intergenic
1148617973 17:49014351-49014373 CAGGGGAAAGCGCAGCAGAGCGG - Intronic
1149291367 17:55220814-55220836 CAGGGGAAAGGGTGGGAGAGGGG - Intergenic
1149502693 17:57166505-57166527 CTGGGGAAAGAGGAGGAGTGGGG + Intergenic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1149783292 17:59415207-59415229 CAAGGGAAACAGCAGAAGAGAGG + Intergenic
1150832093 17:68531967-68531989 CCTGGGAAAGGGCAGGAGAAGGG - Exonic
1151362952 17:73599573-73599595 GAGGGAAAAGAGGAGGAGAGAGG + Intronic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151483654 17:74385147-74385169 CAGGGGAAGGAAAAGGAAAAGGG + Intergenic
1151518459 17:74612441-74612463 CAGGGGACTGGGGAGGAGAAAGG + Exonic
1151556905 17:74851311-74851333 CAGGGGCAGGACCAGGAGATAGG + Intronic
1151663389 17:75531639-75531661 CTGGGGACAGGGCAGGAGACGGG + Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1151958173 17:77391004-77391026 GATGGGACCGAGCAGGAGAAGGG + Intronic
1152008498 17:77696852-77696874 GAGGGGAAGGAGGAGGAGAAGGG - Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152343735 17:79739156-79739178 CAGGGGAAAGAGCCAGGGACAGG + Intronic
1152881922 17:82822504-82822526 CAGCGGAAAGAGCAGAAGAGTGG + Intronic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153506488 18:5804394-5804416 CAGGAGAAAGAGAGGGAGAGAGG - Intergenic
1153800122 18:8661347-8661369 CAAGAAAAAGAGCAGGAGAGAGG + Intergenic
1153826630 18:8881445-8881467 TAGGGGAAAGGGAAGGAGAGAGG - Intergenic
1153950982 18:10057487-10057509 TAGGGGACAGGGAAGGAGAATGG + Intergenic
1154051732 18:10966766-10966788 CGGGGGAAAGGGCAGGAGGTGGG - Intronic
1154299512 18:13180925-13180947 GAGGGGAAAGAGGAGGGGTATGG - Intergenic
1154458325 18:14551455-14551477 CAGGAGGCTGAGCAGGAGAATGG - Intergenic
1154939466 18:21096569-21096591 AAAGGGAAAGAACAAGAGAATGG + Intronic
1154975432 18:21452819-21452841 CAGAAAAAAGAACAGGAGAAAGG + Intronic
1155276609 18:24194096-24194118 AACAGGAGAGAGCAGGAGAAAGG + Intronic
1155362531 18:25016679-25016701 CAGGGGAAGGTGGTGGAGAAGGG + Intergenic
1155555863 18:27018831-27018853 CAGGAGAGAGAGCAGGAGAATGG + Intronic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1155655196 18:28184435-28184457 AAAGGGAAAGAGAGGGAGAAAGG - Intergenic
1155728962 18:29127916-29127938 CAGGAGAGAGAGAAGGCGAAGGG + Intergenic
1155789361 18:29946171-29946193 GAGGGGAAAGAGGAAGGGAAGGG + Intergenic
1156463245 18:37333371-37333393 GAGGGGAAAGAGGGGAAGAAGGG - Intronic
1156723926 18:40104582-40104604 AAGGGGAAGGGGCAAGAGAATGG + Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157145554 18:45158977-45158999 GAGGGAAAGGAGGAGGAGAAAGG - Intergenic
1157624264 18:49036844-49036866 AAGGAGAAAGGGCAGGAGAGAGG - Intergenic
1157688568 18:49662484-49662506 GAGGGGAGAGGGCAGGAGATGGG + Intergenic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1158377113 18:56883657-56883679 CAGGGGAAAGGGTGGGAGAGGGG - Intronic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159079763 18:63724107-63724129 GAGGAGGAAGAGGAGGAGAAGGG - Intronic
1159310234 18:66698388-66698410 AAGGTGAAGGAGGAGGAGAAAGG + Intergenic
1159310258 18:66698457-66698479 GAGGAGAAGGAGGAGGAGAAAGG + Intergenic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1159489497 18:69112515-69112537 CAGAGGAAAGGGCAAGAAAATGG - Intergenic
1159624689 18:70679034-70679056 AAGGGGAAAGAGAAGAGGAAGGG - Intergenic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1159752650 18:72322018-72322040 GAGGTTAAAGAGCAGGACAATGG + Intergenic
1159872824 18:73777665-73777687 AAGGGGAAAGAGGAAGAAAATGG + Intergenic
1160107564 18:75992541-75992563 GAGGGGGAAAAGCAGGACAAAGG - Intergenic
1160383654 18:78479795-78479817 CTGAGGAAAGAAAAGGAGAAAGG - Intergenic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1160820140 19:1054080-1054102 CAGGAGACAGCGCTGGAGAACGG + Exonic
1160925356 19:1542255-1542277 GAGGAGAAAGAGGAAGAGAAGGG - Intergenic
1161656120 19:5516125-5516147 AGGGGGACAGAGGAGGAGAACGG - Intergenic
1162180891 19:8867927-8867949 CAGGTGAATGGGCAGGAGGATGG + Intronic
1162690511 19:12426035-12426057 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1162777252 19:12987372-12987394 GAGGGGAGAGGGAAGGAGAAGGG + Intergenic
1162846637 19:13397817-13397839 AAGGGAAAAGAGCATGAGAAGGG - Intronic
1162968430 19:14166532-14166554 CAGGGGAAGGAGGAAGAGAGAGG + Intronic
1163003786 19:14384719-14384741 AAGGGGAAACAGGAGGAGATGGG - Intronic
1163117656 19:15197961-15197983 CAGGGGTAATAGAAGGGGAAGGG + Intronic
1163176580 19:15568295-15568317 CAGGTGATAGAGCAGGGGATAGG - Intergenic
1163467092 19:17474557-17474579 AAGTGGGAAGAGCAGGAGACAGG - Intronic
1163976623 19:20858847-20858869 TAGGGGAAAGGGAAGGAGAGGGG + Intronic
1164249795 19:23466689-23466711 AAGGAGAAAGAGGAGGAGAGGGG - Intergenic
1164419769 19:28078705-28078727 TAGGGGAAAAAGCAGGCCAAAGG - Intergenic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164574853 19:29399925-29399947 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1164590751 19:29505477-29505499 CAGGGGTCAGAGGTGGAGAATGG - Intergenic
1164686868 19:30172442-30172464 GAGGGGCTGGAGCAGGAGAAGGG + Intergenic
1164712559 19:30367880-30367902 CATGGGAAGGTGCAGGAGGAAGG - Intronic
1164720014 19:30425086-30425108 CAAGGGAAAGAGTAGGAAAGGGG + Intronic
1164743578 19:30594731-30594753 CAGGGGAAACAGGAGAAGAGTGG - Intronic
1164908333 19:31985554-31985576 TGGGGGAAAGAGGAAGAGAAGGG + Intergenic
1164937041 19:32223150-32223172 AAGAGAAAAGAGGAGGAGAAAGG + Intergenic
1165416080 19:35694288-35694310 AAGGGGAAGGGGGAGGAGAAGGG - Intergenic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165756233 19:38294756-38294778 CTGGGTAAAGATCAGGACAAAGG + Intronic
1165783960 19:38450149-38450171 CAGGGGACAGAGCCAGAGCAGGG + Intronic
1165792933 19:38502804-38502826 CAGGGGGAGGAGCAGGGGCAGGG + Intronic
1166585603 19:43945332-43945354 CAGAAGACAGAGCTGGAGAAGGG - Intergenic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1166730846 19:45058190-45058212 GAGGGAAGAGAGCAGGAGAGAGG - Intronic
1166880816 19:45929017-45929039 CAGGGGCAAGTGATGGAGAATGG - Intergenic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1166970893 19:46566836-46566858 CAAGAGAATGAGCAAGAGAATGG + Intronic
1167019354 19:46861992-46862014 CAGGGGAATGAGCTGGGGCACGG - Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167269107 19:48498139-48498161 GAGGAGAAAGCGCTGGAGAATGG - Exonic
1167440676 19:49507018-49507040 GAGGGGAAGGAGAAGGGGAAGGG - Intronic
1167564797 19:50249463-50249485 CAGGGGACAGAGCCAGAGACAGG - Intronic
1167622889 19:50568711-50568733 CAGGGGAGAGAGGAGGGAAAGGG + Intergenic
1167644629 19:50699144-50699166 CATGGAAGAGAGCAGGAGATGGG + Intronic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168028061 19:53658019-53658041 CAGGGGAAAGGGCTGGAGCCAGG - Intergenic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168485129 19:56755006-56755028 AAGGGGAAAATGAAGGAGAAAGG + Intergenic
1168545444 19:57245864-57245886 TCGGGGGAAGAGGAGGAGAAAGG - Intronic
1168703004 19:58452637-58452659 CAGGGGAAAGATCAAGAGTCTGG + Intronic
1168705495 19:58468155-58468177 CAGGGGAAAGATCAAGAGTCTGG + Intronic
924964728 2:65268-65290 CAGGGGAAAGAGGAAGACAGTGG + Intergenic
924988165 2:289036-289058 CAGGGGGAAGAGGAGGAGACGGG - Intergenic
925548288 2:5041746-5041768 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
925573398 2:5334875-5334897 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
925573406 2:5334893-5334915 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
925573414 2:5334911-5334933 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925812336 2:7712732-7712754 TAGGGGAAAGAGCAGGACACAGG + Intergenic
926179473 2:10628498-10628520 CAATGGATAGAGTAGGAGAAGGG - Intronic
926305785 2:11636717-11636739 CAGGGGCAAGGGCAGGGGTAAGG + Intronic
926305800 2:11636753-11636775 CAGGGGCAAGGGCAGGGGCAGGG + Intronic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926459276 2:13108985-13109007 CAGGGGAAAAGGTGGGAGAAGGG + Intergenic
926756997 2:16244377-16244399 GAGGGCAAGGAGGAGGAGAAGGG + Intergenic
926834427 2:17001935-17001957 CACGAGAAAGAGCTGGAGATGGG + Intergenic
927001736 2:18802594-18802616 CAGGGGAAAGAAAAGGATAATGG + Intergenic
927215464 2:20666074-20666096 CAGGGGAACGCGCAGGAGAGGGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927716760 2:25358258-25358280 GAGGGGGAAGAACAGGAAAAAGG - Intergenic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928318242 2:30262691-30262713 GAGGGGAAAGGCAAGGAGAAGGG + Intronic
928431860 2:31226793-31226815 GAGGGGAATGGGCAGGTGAATGG - Intronic
928654179 2:33432540-33432562 GAGGGGAGAGAGCAGGGCAATGG - Intergenic
928691247 2:33801433-33801455 CAGGGGAGACAGTAGGAGAGAGG + Intergenic
929013602 2:37472337-37472359 GAGGAGGAAGAGAAGGAGAAAGG + Intergenic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929481229 2:42310323-42310345 AAGGGGAAGGAGAAGGGGAAGGG - Intronic
929481232 2:42310329-42310351 AAGGGGAAGGGGAAGGAGAAGGG - Intronic
929783973 2:44975949-44975971 CAGGAGAAAGAGCAGAAGCCGGG + Intergenic
930014038 2:46958467-46958489 AAGAGGAGAGAGCAGGAGACAGG - Intronic
930021517 2:47004659-47004681 GAGGGGAATGAGCAGGAGAAGGG + Intronic
930037029 2:47092629-47092651 CAGAGGGGAGAGGAGGAGAAAGG + Intronic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
930273836 2:49288389-49288411 CTGAGGGAAGAGCAGGAGAGAGG - Intergenic
930277529 2:49331036-49331058 CAGGAGAGAGAGCAAGCGAAGGG + Intergenic
930288566 2:49465459-49465481 AAGGGGAAAGGGAAGGGGAAAGG - Intergenic
930324538 2:49898987-49899009 CAGGAGAGAGAGCAAGAGAGGGG + Intergenic
930343859 2:50152913-50152935 GAGGGAGAAGAGAAGGAGAAAGG - Intronic
930563805 2:52994697-52994719 GAGGGGGAAGGGTAGGAGAAGGG + Intergenic
931502203 2:62881461-62881483 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
931540749 2:63326492-63326514 AAAGGGAAAGACCAGCAGAAAGG + Intronic
931578230 2:63743137-63743159 CAGGAGAAAGAGCACTGGAATGG - Intronic
931812008 2:65863251-65863273 CATGGGACAGAGCAGGAAAACGG - Intergenic
931826297 2:66004184-66004206 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
931903274 2:66815081-66815103 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
931918479 2:66985895-66985917 TATTGGGAAGAGCAGGAGAAAGG + Intergenic
931985388 2:67736657-67736679 AAGGGGATGGAGGAGGAGAATGG - Intergenic
932050753 2:68395657-68395679 CTGGGGAAAGAGAAGGCAAATGG - Intronic
932099416 2:68883907-68883929 AAGGAGAAAGAAAAGGAGAAAGG - Intergenic
932369361 2:71174637-71174659 GAGGTGAAAGAGGAGGAGAGTGG + Intergenic
932383931 2:71313308-71313330 AAGGGGAAAGGGAAGGGGAAGGG - Intronic
932406395 2:71515588-71515610 AGGAGGAAAGAGCAGGAGGAAGG - Intronic
932625951 2:73295968-73295990 CAGAGGGAAGAACAGCAGAAGGG - Intergenic
932634243 2:73373997-73374019 CAGGACCAAGAGCAAGAGAAGGG - Intergenic
932635315 2:73383196-73383218 AAGGGGAAAGGGAAAGAGAAAGG - Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933194549 2:79373541-79373563 CAGGGCAAAGAACTGCAGAAGGG + Intronic
933456455 2:82525639-82525661 CTGGGAGAAGAGCAAGAGAATGG + Intergenic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
933826785 2:86168844-86168866 CAGGGGATACAACAAGAGAAAGG + Intronic
933888129 2:86739412-86739434 CAGGAAAAAAAGGAGGAGAAGGG - Intronic
933922049 2:87057294-87057316 CAGGAAAAAAAGGAGGAGAAGGG + Intergenic
934065127 2:88333382-88333404 GATTGGCAAGAGCAGGAGAAGGG + Intergenic
934185639 2:89671467-89671489 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
934316804 2:91929113-91929135 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
934670035 2:96206375-96206397 GAGGAGAAAGACCAGGAAAAGGG - Intronic
934761873 2:96861038-96861060 CTGCGGGAAGAGCTGGAGAAAGG - Exonic
934779086 2:96957732-96957754 AAGAAGAAAGAGCTGGAGAAAGG - Intronic
934939273 2:98488781-98488803 CAGGGAAAGGACCAGGAGACTGG + Intronic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935175180 2:100642807-100642829 TAGGGGAAATAGCAGGGCAAAGG + Intergenic
935184420 2:100718595-100718617 GAGGGAAAGGAGCAGGTGAAAGG + Intergenic
935308365 2:101759563-101759585 GAGGGGAGAGAGGAGGGGAATGG - Intronic
935426627 2:102925722-102925744 CTGGGGAAAAAAAAGGAGAAAGG + Intergenic
935531624 2:104239618-104239640 CAGGGCAAAGAGCAGGGTATAGG + Intergenic
935554985 2:104499525-104499547 CACAGGAAAGATCAGAAGAAGGG - Intergenic
936001545 2:108835955-108835977 AGGGTGGAAGAGCAGGAGAAAGG + Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
937057493 2:118952028-118952050 TAGGGGAAGGGGAAGGAGAAGGG - Intronic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937237026 2:120437224-120437246 GAGATAAAAGAGCAGGAGAAGGG + Intergenic
937241296 2:120464252-120464274 AAAGGGAAAGAGCAGGAAAAGGG + Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937619616 2:123970719-123970741 AAGGGGAAAGAGAAGGAAAGAGG + Intergenic
937749724 2:125460808-125460830 CAAGGGAAAAAGAAAGAGAAGGG - Intergenic
938043413 2:128095383-128095405 AAGGGGAAGGAGAAGGGGAAGGG - Intronic
938043416 2:128095389-128095411 AAGGGGAAGGGGAAGGAGAAGGG - Intronic
938064332 2:128272938-128272960 CAGGGGCAACGGCAGGGGAAAGG + Intronic
938360883 2:130685274-130685296 CAGGGGTGAGAGCAGGGAAATGG + Intergenic
938475534 2:131608234-131608256 CAGCAGCAAGAGCAGGAGCAAGG - Intergenic
938945192 2:136206049-136206071 CTGGGGAAAGGGTAGAAGAATGG - Intergenic
938973752 2:136456305-136456327 AAGGGGAAGGTGAAGGAGAAGGG - Intergenic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939385788 2:141495352-141495374 CATGGTAATGAGCAGGAAAATGG + Intronic
939701627 2:145399728-145399750 CAGGGGACAAAGCAAGTGAAGGG + Intergenic
939849275 2:147284549-147284571 CAGGTGGCAGAGCAGGAGAATGG - Intergenic
940196013 2:151094845-151094867 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
940216145 2:151305426-151305448 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
940268854 2:151869701-151869723 CAGAGGGATGAGCAGGAGAGTGG - Intronic
940483271 2:154263822-154263844 CAGGTGAATGACGAGGAGAATGG - Intronic
940775015 2:157876091-157876113 CGGGGGAAAGAGCCGGGGGAGGG + Intergenic
940971510 2:159901607-159901629 CAGTGGAAAAAGCAGGAGTTAGG + Intronic
941105819 2:161351585-161351607 CAGGGGAAAGAGGAGGGTAAGGG - Intronic
941234024 2:162946629-162946651 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
941514452 2:166455544-166455566 GAGGGGGAAGAGAAGGGGAAGGG + Intronic
941680848 2:168397298-168397320 GAGGTGGAAGAGTAGGAGAAGGG - Intergenic
941736318 2:168980923-168980945 CAGGGTAGAGAGGAGGAGACTGG - Intronic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
942471499 2:176265420-176265442 CAGGAGGAAGAGAAAGAGAAGGG - Intergenic
942692578 2:178601967-178601989 CAGTGGAAAAAAGAGGAGAATGG + Intronic
942746290 2:179237318-179237340 CATCGGAAAAACCAGGAGAATGG - Intronic
942839334 2:180340588-180340610 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
942942232 2:181631778-181631800 AAGGGGAAAGAGAAGGAAATGGG + Intronic
943420054 2:187658658-187658680 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944201895 2:197116614-197116636 GAGGAGAAAGAGCCAGAGAAAGG - Intronic
944216707 2:197263510-197263532 CATGGGGAAGAGGATGAGAAAGG - Intronic
944316332 2:198289370-198289392 GAGGGGAAAGAGAAAGAGACAGG - Intronic
944743253 2:202632940-202632962 AGGGGGAGAGAGGAGGAGAAAGG + Intergenic
944869636 2:203896934-203896956 CAGAGGAAGGAGCTTGAGAAAGG + Intergenic
945176455 2:207048402-207048424 GAGGGGAAAAACCAGCAGAAAGG - Intergenic
945264941 2:207881778-207881800 CACTGGAAAGAGTAGGAGAAAGG - Intronic
945485373 2:210389250-210389272 GAAAGGAAAGAGCTGGAGAATGG - Intergenic
945655376 2:212616613-212616635 GAGGGGAGAGAGGAGGGGAAGGG - Intergenic
945655391 2:212616647-212616669 GAGGGGAGAGAGGAGGGGAAGGG - Intergenic
945711974 2:213307994-213308016 CTTGGGAAAGAGAAGGCGAAAGG + Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946391201 2:219418057-219418079 CAGGGGAGACAGCAGAAGAGAGG - Intergenic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946451118 2:219780309-219780331 CAGGGCAAATATCAGGAGAAAGG + Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946670910 2:222103250-222103272 GAGGGGAAAAAGCATAAGAAAGG + Intergenic
947223879 2:227821671-227821693 GTGGTCAAAGAGCAGGAGAATGG + Intergenic
947782385 2:232780197-232780219 AAGGAGAAAGAGCAGTAAAAGGG - Intronic
947854369 2:233313234-233313256 CAGGTGAAAGTGCAGCAGAAGGG + Intronic
948170199 2:235895313-235895335 CTGGGGCAAGAGCAGGGGCACGG - Intronic
948344332 2:237282667-237282689 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948344335 2:237282673-237282695 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
948344346 2:237282697-237282719 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948344349 2:237282703-237282725 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948748194 2:240110734-240110756 GAGGGGAAGGAGAAGGAGAGTGG - Intergenic
948779887 2:240312599-240312621 CAGGGGAAAGGGTGGGAGAGGGG - Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
948859698 2:240746841-240746863 CAGGCGAAGGAGCAGGCGAAGGG + Intronic
948952458 2:241263072-241263094 CAGCCGAAAGACAAGGAGAAAGG + Intronic
1169074119 20:2751028-2751050 AAGGGGAAGGAGGAGGAGAAGGG + Intronic
1169255157 20:4091509-4091531 CCCGGGAAAGAGGAGGAGAGAGG + Intergenic
1169384978 20:5141077-5141099 GAGAGAAAGGAGCAGGAGAAAGG - Intronic
1169457354 20:5763602-5763624 TAGGGGAAAGAGGAAGAGTATGG - Intronic
1169511564 20:6269500-6269522 AAGGGGAAAGAGCTGAGGAAGGG - Intergenic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169655242 20:7915353-7915375 AAGGGGAAGGAGAAGAAGAAGGG + Intronic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170105691 20:12752721-12752743 GAAGGGAAGGAGGAGGAGAAAGG - Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170337456 20:15286005-15286027 CAGGTGAAAGAGGTGGAGATGGG - Intronic
1170356318 20:15495939-15495961 AAGAGGAAAGAGCATGAGCAAGG + Intronic
1170440984 20:16378421-16378443 AAGGGGAAAGAGAGGGAGACAGG + Intronic
1170489852 20:16861938-16861960 CAGTGGACAGAGGAGGAAAATGG + Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1170930175 20:20762549-20762571 GAGGGCACAGAGCAAGAGAAGGG - Intergenic
1171074672 20:22110545-22110567 CAGGGGAAAGAGCAGGCAAGGGG - Intergenic
1171079530 20:22164551-22164573 AAGGGGAAAGAGCAAAAGAAAGG + Intergenic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171151431 20:22829501-22829523 GAGGGGAGAGAGCGGGAGGAGGG - Intergenic
1171249115 20:23635373-23635395 CATGTGAAAGAGCAGGAGGCAGG + Intronic
1171377306 20:24702432-24702454 CAGGGGCAGGAGCAGGGGATGGG + Intergenic
1171506738 20:25642450-25642472 CAGCAGAAGGTGCAGGAGAAAGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172438192 20:34945400-34945422 CAAGGGAAAGAGACAGAGAAGGG + Intronic
1172705748 20:36880872-36880894 CAGGGGAATGAGCAGGGCAGTGG + Intronic
1173032799 20:39377996-39378018 CAGGTGAAAGAGGAAAAGAAAGG - Intergenic
1173113064 20:40213490-40213512 CAGGGGCTGAAGCAGGAGAATGG + Intergenic
1173118576 20:40269552-40269574 CAGAGCAAAGAGCAGGACAGGGG - Intergenic
1173646489 20:44636300-44636322 CAGGGGGAAGAGAGAGAGAAAGG + Intronic
1173890687 20:46507239-46507261 CAAGGGAAAGGGAAGGGGAAGGG + Intronic
1173995020 20:47331368-47331390 AAGGGCAAAGAACAGAAGAATGG + Intronic
1174062350 20:47841737-47841759 CAGGTGAAAAAGAAAGAGAAGGG - Intergenic
1174121877 20:48271957-48271979 CAGGGGAAACAGCTTGAGATTGG - Intergenic
1174216519 20:48920743-48920765 GAGGGGAAAGAGTAGGAGAAAGG - Intergenic
1174259635 20:49284528-49284550 CAGGGGAAATAGTAAGAAAAAGG - Intergenic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1174709522 20:52690257-52690279 AAGGGGAAGGAGAAGGGGAAAGG - Intergenic
1174709524 20:52690263-52690285 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1175051655 20:56161135-56161157 CAGAGGAAAGAGCAAGTGCAAGG - Intergenic
1175127961 20:56766541-56766563 CAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175298837 20:57928590-57928612 GAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1175319921 20:58078417-58078439 CAGGGGGAAGAAGAGAAGAAAGG + Intergenic
1175531014 20:59674364-59674386 AAGGGGAAGGAACAGGAGAAGGG - Intronic
1175531033 20:59674430-59674452 AAGGGGAAGGAACAGGAGAAGGG - Intronic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175547219 20:59786150-59786172 CTGGGGAATGAGCAGGGCAAAGG - Intronic
1175614998 20:60390472-60390494 GAGGGGAAAGGGAAGCAGAAGGG - Intergenic
1175699305 20:61125468-61125490 CAGGGGGAGGGGAAGGAGAAGGG + Intergenic
1175707621 20:61192756-61192778 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1175733627 20:61370915-61370937 CGGGGGAAAGGGAGGGAGAAAGG - Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175789170 20:61730986-61731008 CAGGGGAAGGAGCAGCTGAGGGG + Intronic
1175801143 20:61801650-61801672 AACGGGAAAGGGCAGGAGATGGG - Intronic
1175888250 20:62304246-62304268 CGGGGGAGAGAGCAGGGAAAGGG - Intronic
1176035718 20:63035545-63035567 CAGGTGACGGAGCAGGGGAATGG - Intergenic
1176115024 20:63428436-63428458 CTGGGGCAAGAGAAGGAGAGGGG + Intronic
1176162831 20:63657205-63657227 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
1176195781 20:63835899-63835921 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195795 20:63835937-63835959 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195809 20:63835975-63835997 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195823 20:63836013-63836035 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195847 20:63836078-63836100 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195876 20:63836160-63836182 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195890 20:63836198-63836220 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195944 20:63836350-63836372 CAGGGGAGAGGGCAGGGGAGAGG + Intergenic
1176195950 20:63836362-63836384 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176695205 21:9968864-9968886 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
1176815827 21:13601881-13601903 CAGGAGGCTGAGCAGGAGAATGG + Intergenic
1177114866 21:17073349-17073371 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1177262515 21:18749290-18749312 AATGGGAAAGAGCAGCAGGAAGG + Intergenic
1177563897 21:22794069-22794091 CAGGCAAATGGGCAGGAGAAAGG + Intergenic
1177724979 21:24955614-24955636 GAGGGGAAACAGTAGGATAAGGG - Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177955892 21:27598729-27598751 CAAGAGAAAGAATAGGAGAACGG - Intergenic
1177967009 21:27740259-27740281 CAGTGGTAAGAGGGGGAGAAGGG + Intergenic
1178225366 21:30710910-30710932 GAGAGGAAAGAGGAGGGGAAGGG + Intergenic
1178422721 21:32455229-32455251 AAGGGGCAAGAGAAGGAGAGAGG + Intronic
1178459680 21:32791495-32791517 AAGGGGAAAAAGGAGGAAAAAGG - Exonic
1178881008 21:36450092-36450114 GAGGGGAAAGGGCACGAAAAGGG - Intergenic
1179896054 21:44364361-44364383 CTGGGGCAAGAGCAGGAGGCTGG + Intronic
1180104268 21:45607619-45607641 GAGGGGAAAATGGAGGAGAAAGG + Intergenic
1180543135 22:16471460-16471482 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1180638441 22:17279109-17279131 CAGTGCAAAGAGCAAGGGAAGGG - Intergenic
1180883867 22:19225781-19225803 CACGGGAAAAAGTAGGAGCAAGG + Intronic
1180938290 22:19640292-19640314 CAGGGGCAAGGGGAGGAGAATGG - Intergenic
1181034818 22:20164814-20164836 GAGGGGCAGGGGCAGGAGAAGGG + Intergenic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181787455 22:25237475-25237497 CAGGAGGAAGAGCAGGGAAAGGG - Intergenic
1181860895 22:25817432-25817454 AAGGGGAAAGAGAAAGGGAAAGG - Intronic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182048994 22:27298997-27299019 AAGGAGAAAGAGAAGAAGAAGGG + Intergenic
1182113190 22:27738861-27738883 CTGGGAGAAGGGCAGGAGAATGG + Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182332276 22:29559678-29559700 GTGGGGCAAGAGAAGGAGAAGGG - Intronic
1182444212 22:30380775-30380797 CAGGAGGAAGTGCAGGAGGATGG - Intronic
1182675731 22:32037825-32037847 CAGGGGAAAGACGGGGAGAGGGG + Intergenic
1182754559 22:32668376-32668398 GAGGGGAAAGAGAAGGGGAAAGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182881710 22:33739315-33739337 CAGGGGCAGGAACAGGAGACAGG - Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1183092054 22:35529137-35529159 CAGAGGAAAGGGCAGCAGAGGGG - Intergenic
1183422358 22:37719258-37719280 GAGGGGACAGAGAAGGAGAGAGG + Intronic
1183529834 22:38347392-38347414 CAGGGGCATGAGCAGGAGCCTGG + Intronic
1183620095 22:38967130-38967152 CAGGGGAATCAGCAGGACAGGGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183632660 22:39042761-39042783 CCGGGGAGAGAGCAAGAAAAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184100769 22:42340849-42340871 GAGGGGAAAGGGGAGGGGAAAGG + Intronic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184379023 22:44133505-44133527 TAAGGGAAATAGCAAGAGAAAGG - Intronic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184481918 22:44752876-44752898 CAGGGGAAAAAGCAGAGGAGGGG - Intronic
1185015279 22:48339236-48339258 AAGGGGAAGGAGGAGGAGAGAGG + Intergenic
1185071593 22:48659597-48659619 CAGGGAGAAAAGCAGGACAAGGG - Intronic
1185089358 22:48757173-48757195 GATGGGAAGGAGGAGGAGAAGGG + Intronic
1185089370 22:48757212-48757234 GATGGGAAGGAGGAGGAGAAGGG + Intronic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
949323686 3:2840362-2840384 GAGGAGAAAGAGGAGGAGAAGGG - Intronic
949493504 3:4610902-4610924 GAAGGGAAGGAGAAGGAGAAGGG - Intronic
949494532 3:4619555-4619577 AAGGGGAAAGGGCAGGGGAAGGG - Intronic
949807671 3:7973659-7973681 CAGGGGAGAGGGGAGGAGAGAGG + Intergenic
949973721 3:9434821-9434843 TAGGGGAATGAGCAGGGGGAAGG + Exonic
950314305 3:11986984-11987006 AAGGGGAAGAAGCAAGAGAAAGG - Intergenic
950342861 3:12263016-12263038 CAGAGGAGAGAGAAGGACAAAGG + Intergenic
950456987 3:13098610-13098632 CAGAGGAAACAGCAGTGGAAAGG + Intergenic
950542207 3:13619382-13619404 CAGGGAAAAAAGCAGGGGAAGGG - Intronic
950620838 3:14203961-14203983 CAAGGCTAAGAGCAGGAAAAGGG - Intergenic
950914358 3:16628806-16628828 TAGGGGAAAGAAGAGGTGAAAGG - Intronic
950932928 3:16809114-16809136 TAGGGAAAGGAGTAGGAGAAGGG + Intronic
951184799 3:19701155-19701177 CTGGGGCATGAGCTGGAGAATGG - Intergenic
951363766 3:21755484-21755506 CAGTAGAGAGAGCAGGTGAAAGG - Intronic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951795921 3:26538222-26538244 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
951800519 3:26590631-26590653 CAGGAAAAAGAGAAAGAGAAGGG - Intergenic
951810143 3:26689609-26689631 ATGGAGAAAGAGCAGGAGAGAGG - Intronic
952092150 3:29900591-29900613 CAGGGGAAAGAGCCCTAGACTGG + Intronic
952255118 3:31688324-31688346 CAGGAGAAAGGGCAGAAAAAGGG - Intronic
952295813 3:32061003-32061025 CGAGGGACAGAGCAGGAGCAGGG - Intronic
952371078 3:32723285-32723307 CAGGAGGCTGAGCAGGAGAATGG + Intronic
952478727 3:33737595-33737617 CAGGGAAAAGAAGAGGGGAAAGG - Intergenic
952489265 3:33850893-33850915 AAGGGGGAAGGGAAGGAGAAAGG - Intronic
952606836 3:35157915-35157937 CAGGGGGAAGAACCGAAGAAGGG - Intergenic
952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG + Intronic
953439961 3:42908634-42908656 CAGGGGAAAGGACAAGAGAGGGG - Intronic
953479157 3:43234528-43234550 CTGGGGAAAGAGGAGGAGTGAGG - Intergenic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
954152028 3:48662563-48662585 GAGGAGAAGGAGCAGGAGTATGG + Exonic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954555998 3:51518209-51518231 CAAGGGAGAGATCAGGGGAATGG - Intergenic
954879587 3:53824258-53824280 CAGGGGATGGGGCAGCAGAAAGG + Intronic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955148014 3:56339338-56339360 CAGGGGAAAGAGAAGTGTAAGGG + Intronic
955733770 3:62015303-62015325 CTGCTGAAACAGCAGGAGAAAGG + Intronic
955783122 3:62507265-62507287 CAGGGGATAGTGCCAGAGAAGGG - Intronic
956240845 3:67128470-67128492 CAGGGGAAAGGGTAGGAGAGGGG + Intergenic
956409016 3:68959517-68959539 CAGGGGGAAGGGCAGGAGGGGGG - Intergenic
956472656 3:69584315-69584337 GGGAGGAAAGAGAAGGAGAAGGG - Intergenic
956682579 3:71795085-71795107 CAGGTGACAGAGCAGGAAATAGG + Intergenic
956781986 3:72610987-72611009 AGGAGGCAAGAGCAGGAGAAAGG + Intergenic
957152097 3:76499083-76499105 CTGGGTAATGAGCAGGAGTAAGG - Intronic
957290397 3:78271019-78271041 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
957382945 3:79457702-79457724 CAGGTGAAAGAGCATGTGCAGGG - Intronic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958584078 3:96062784-96062806 AAGGGGAAGGAGAAGGACAAGGG - Intergenic
959523921 3:107354649-107354671 CAAGAGAAAGAGCAGCAAAAAGG - Intergenic
959902744 3:111678057-111678079 CATGGGAAAGGGCAGGGAAAAGG + Intronic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960223011 3:115138223-115138245 CATGGGTAGGAGCAGGACAAAGG - Intronic
960236030 3:115283189-115283211 TAGTGGATAGAGCAGGAGAAGGG - Intergenic
960405786 3:117257755-117257777 AAGGGGGAAGAGGAGGAGAACGG + Intergenic
960536728 3:118823463-118823485 CAGGGGAAAGTCCAGAATAAAGG - Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960869040 3:122230831-122230853 GAGGGGACAGAGAAGTAGAAGGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961309986 3:125990484-125990506 CTGGGCCTAGAGCAGGAGAAAGG + Intergenic
961316166 3:126037188-126037210 CAAGAGAGGGAGCAGGAGAAGGG - Intronic
961504012 3:127358239-127358261 CAGGGGAAAGAGGAGGCAAGGGG - Intergenic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
961985216 3:131124574-131124596 AAGGGAGAAGAGGAGGAGAATGG + Intronic
962282914 3:134065758-134065780 CAGAGGTGAGAGCTGGAGAAAGG - Intronic
962324532 3:134422462-134422484 CAGGAGCAAGAGAAGGAGAGGGG - Intergenic
962770423 3:138606252-138606274 AAGGAGGAGGAGCAGGAGAAAGG + Intergenic
963602192 3:147388350-147388372 GAGGGGAAAGAAAAGGAGAAAGG - Exonic
964000794 3:151769665-151769687 CAGGAGAGAGAGCAAGTGAAGGG - Intergenic
964304346 3:155324994-155325016 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
964342162 3:155719162-155719184 CAGGGGAAAGGGTAGAAGGAGGG - Intronic
964602989 3:158523769-158523791 GAGAGGAATGAGCAGGAGCATGG + Intronic
964833340 3:160910269-160910291 AAGGGGAAAGGGAAGGGGAAGGG - Intronic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965207912 3:165745291-165745313 CAGCGGAGAGAGCAGGTGACAGG - Intergenic
965622246 3:170653738-170653760 AAGGGGAAAGGGAAGGGGAAGGG - Intronic
965732085 3:171782981-171783003 CATGGTAAAGAGCAGGGGATGGG + Intronic
966001417 3:174953338-174953360 AAGGGGAAAGAGGAGGGGAGGGG - Intronic
966212146 3:177464442-177464464 CAGAGGACAAAGCAGGAAAAGGG - Intergenic
966294373 3:178401968-178401990 TATGGGAAGGAGAAGGAGAAGGG - Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966923541 3:184629875-184629897 CAGGGGGAGGAGGAGGTGAAAGG + Intronic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
967149878 3:186638744-186638766 CAGAACAAAGAGGAGGAGAATGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
967731168 3:192908324-192908346 CATGGGAAAGAACAGGCTAAGGG + Intronic
967841692 3:194010146-194010168 TGAGGGAAATAGCAGGAGAATGG + Intergenic
968094155 3:195916280-195916302 CAAAGGAGAGAGCAGAAGAAAGG - Intergenic
968229458 3:196996717-196996739 CAGTGGAAAGAGCCCGAGATGGG - Intronic
968630623 4:1649138-1649160 AAGGGGAAAGGGAAGGGGAAAGG + Intronic
968630628 4:1649150-1649172 AAGGGGAAAGGGAAGGGGAAAGG + Intronic
968889166 4:3358890-3358912 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
969233936 4:5851928-5851950 GAGGAGGAAGAGGAGGAGAAAGG + Intronic
969511576 4:7620944-7620966 CAGGGGTCGCAGCAGGAGAAGGG - Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969660067 4:8522237-8522259 CAGGGCAAGGAGCAGGGCAAGGG - Intergenic
969664641 4:8550025-8550047 CAGGAGACAGAGCAGGAAATGGG - Intergenic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970103544 4:12554305-12554327 CACAGTAAAGAGCAGTAGAAAGG - Intergenic
970301079 4:14681854-14681876 CAGGAGAAAGAGAAAGAGAATGG + Intergenic
970390620 4:15607744-15607766 TAAGGGTCAGAGCAGGAGAATGG - Intronic
970687310 4:18583210-18583232 CAGGGGACAGAGGAAGACAAAGG + Intergenic
970843115 4:20499592-20499614 CAGGAGGCTGAGCAGGAGAATGG - Intronic
971019148 4:22516379-22516401 AAGGGAAACGAGCAGGAGAGTGG - Intergenic
971115212 4:23638285-23638307 CAGGGGAAAGAGTGGGAGTAAGG - Intergenic
971133851 4:23844966-23844988 CAGGGAAAAGAGTAAGAGTAAGG + Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
971261742 4:25063482-25063504 CAGGGAATGGAGCAGAAGAATGG + Intergenic
972127619 4:35789218-35789240 CAGGGGAGAGAGGAGGGGAAGGG + Intergenic
972169207 4:36324245-36324267 GAGGGGCCAGAGAAGGAGAAAGG - Intronic
972200778 4:36712612-36712634 AAGGTGAAATTGCAGGAGAAGGG - Intergenic
972578669 4:40375599-40375621 GAGGGGAAAGAGGATGAGTATGG - Intergenic
972664317 4:41149456-41149478 CAGGGGAAAGGGCTGAGGAAAGG + Intronic
973655610 4:53044581-53044603 AAGGAGAAAGAGAAGGGGAATGG - Intronic
973815711 4:54617116-54617138 CAGAGGAAAGAAGAGAAGAATGG + Intergenic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974855144 4:67452426-67452448 CAGGAGAAAGAGAAAGTGAAGGG - Intergenic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
975360214 4:73460931-73460953 GAGGGGAAGGAGGAGGGGAAGGG - Intergenic
976160535 4:82193795-82193817 AAGGGGAAAGAGCCAGAGAGAGG - Intergenic
976753830 4:88477481-88477503 GAGGGGAAGGAGAAGGTGAAGGG + Intronic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
976916354 4:90379928-90379950 CAGGGGCAAGAGGAAGAGAAGGG + Intronic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
977049754 4:92115195-92115217 CAGGGGAAAGAGAGTGAGAGGGG - Intergenic
977060995 4:92256669-92256691 AAGTGCAAGGAGCAGGAGAAGGG + Intergenic
977088031 4:92629513-92629535 AAGGGGAAAGAGGTGGAAAATGG + Intronic
977153495 4:93544077-93544099 CAGAGGAAAGTGCAGGAAATTGG + Intronic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977645385 4:99405894-99405916 CAGGGGAAAGGGTGGGAGAAGGG + Intergenic
977663733 4:99620832-99620854 CAGGGGAGAGCTCAGGGGAAGGG + Intronic
977894857 4:102351933-102351955 CAGGTGAAACAGCAGCATAAAGG - Intronic
977948643 4:102943738-102943760 TAGGGGGAAGAGTAGGAGGAGGG + Intronic
978083564 4:104622672-104622694 CAGGGAAAAGAGCCCGAGCATGG + Intergenic
978122240 4:105093507-105093529 CAGGGGAAATAACAACAGAATGG - Intergenic
978282028 4:107028982-107029004 AATGGGAAAGAGTAGAAGAAAGG + Intronic
978328608 4:107587095-107587117 GAGGGGATAGAAAAGGAGAAAGG + Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978823699 4:112994746-112994768 CAGAGGAAAGAAGGGGAGAAAGG - Intronic
978995226 4:115143275-115143297 AAGGGAAAAGAGCAGCAAAAAGG + Intergenic
979150275 4:117304485-117304507 CAGGTGAAAGAGAAGGTGAAAGG + Intergenic
979215506 4:118159135-118159157 CAGGGGACAGAGGGGCAGAAGGG + Intronic
979251941 4:118574840-118574862 AAGGGGAAAGAGCAGCAGGAGGG - Intergenic
980367832 4:131829073-131829095 TTGGGGAAAGAGAAGGAGATTGG - Intergenic
980367836 4:131829092-131829114 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
980505139 4:133709304-133709326 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980774966 4:137425827-137425849 CAGGTGAAAGAACTGGAGAAGGG - Intergenic
980992050 4:139746720-139746742 AAAGGGAGAGAGGAGGAGAAGGG - Intronic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981271918 4:142855381-142855403 GAGGAGGAAGGGCAGGAGAATGG - Intergenic
981354070 4:143766724-143766746 AAGGGGAAAGGGAAGGGGAAGGG - Intergenic
981616650 4:146649973-146649995 AGGGGGATATAGCAGGAGAATGG - Intergenic
981813178 4:148798738-148798760 TGGAGGAAAGAGCAGGAAAATGG + Intergenic
982867449 4:160533939-160533961 CAGGAGGCCGAGCAGGAGAATGG + Intergenic
983261489 4:165461537-165461559 GAGGGAAAAGAGCTGGAGAGAGG + Intronic
983897056 4:173092433-173092455 GTGGGAAAAGAGCTGGAGAATGG + Intergenic
984002194 4:174262993-174263015 CAGAGAGCAGAGCAGGAGAATGG - Exonic
984376271 4:178934675-178934697 AAGGGAAATGAGAAGGAGAAAGG - Intergenic
984383329 4:179023597-179023619 CAGGAGAAAGAGCAGAACAAAGG - Intergenic
984496347 4:180502814-180502836 CAGGTGGAAGAGGAGGTGAAAGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984743106 4:183186651-183186673 CTGGGGTAAGGGCAGGAGACTGG + Intronic
984911412 4:184676878-184676900 GAGGGGAAGGGGGAGGAGAAGGG - Intronic
985329993 4:188821521-188821543 CAGAGGGAAGAGCAAGAGCACGG + Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985474462 5:71612-71634 CAGGACACAGGGCAGGAGAAGGG - Intergenic
985522906 5:387225-387247 CAGAGGAGAGAGCAGGAGACAGG - Intronic
985534563 5:456729-456751 CAGGGGAAAGTGCAGGGCAGGGG - Intronic
985790860 5:1926309-1926331 AAGGGGCAAGAGCAGGGGAAGGG - Intergenic
985790916 5:1926459-1926481 CAGGGGAAGGGGCAGGCGTAGGG - Intergenic
985790920 5:1926471-1926493 CTGGGACAAGAGCAGGGGAAGGG - Intergenic
986212318 5:5685668-5685690 CAGGGGCAAGGACAGAAGAAAGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986788147 5:11134124-11134146 CTGAGGAGGGAGCAGGAGAAAGG + Intronic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987239634 5:15981903-15981925 AAGGGGGAAGAGAGGGAGAAAGG + Intergenic
987436442 5:17900287-17900309 CAGGGGAAAGAGTGGGAGTGGGG - Intergenic
988873539 5:35417977-35417999 CAGAGGGAAGAGGAGGAGAATGG - Intergenic
989098894 5:37806553-37806575 CAGGGGCAAAAGCAGAAGCATGG - Intergenic
989170190 5:38465977-38465999 CAGGTGAGAGAGCAGCAGAGTGG + Intergenic
989291769 5:39775952-39775974 CAGGGGAAAGAACACCATAAGGG - Intergenic
989645104 5:43622385-43622407 TATGGGAAAGGGCAGGAGAAAGG - Intronic
989741545 5:44779244-44779266 AAGGGGAAAGGGAAGGGGAAAGG + Intergenic
989774459 5:45186671-45186693 CTAGGGAAAGAGCTGGAAAATGG - Intergenic
990005148 5:50937268-50937290 AAGGTGAGAGAGCAGGAGAAAGG + Intergenic
990136177 5:52646032-52646054 CAGGAGAAAGAAAGGGAGAAGGG - Intergenic
990310576 5:54534108-54534130 TACGGGAAAGAACAGGAGACAGG - Intronic
990664898 5:58061334-58061356 TTTGGGAAAGAGCAGCAGAAGGG - Intergenic
990742532 5:58926708-58926730 CAGGGGAAAGAGGAAGGGCAGGG + Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991014350 5:61915355-61915377 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
991334249 5:65529590-65529612 CAGGGGCTGGGGCAGGAGAATGG - Intronic
991516746 5:67444722-67444744 AAGGGGAAAGAGTAATAGAATGG - Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
991960202 5:72036768-72036790 AAGGAAACAGAGCAGGAGAATGG + Intergenic
991968706 5:72117619-72117641 CAGGAGAAAGGAGAGGAGAATGG - Intronic
992024260 5:72654939-72654961 GAGGGAAAAGAGGAGGAAAATGG - Intergenic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992163539 5:74025955-74025977 CTTGGAACAGAGCAGGAGAAGGG + Intergenic
992220009 5:74562466-74562488 CAGGGGAAAGGGTGGGACAAGGG + Intergenic
992319898 5:75603481-75603503 CAGTGGAATGAGTAGGAAAAGGG + Intergenic
992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG + Intergenic
992756309 5:79909897-79909919 CTGGGGAAAAGGCATGAGAAGGG - Intergenic
992791600 5:80219141-80219163 CAGAGGCAAGATCAGGGGAAGGG + Intronic
992892084 5:81213115-81213137 CAGGGAGAAGGCCAGGAGAAAGG - Intronic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993176648 5:84494879-84494901 CAGGAGAGAGAGCAAGAGCAAGG + Intergenic
993390837 5:87318547-87318569 CAGGAGAAACAGCATGTGAAGGG + Intronic
993505567 5:88704905-88704927 CAGGGGAAAGGGTGGGAGAGGGG + Intergenic
993534871 5:89070883-89070905 CAGGGGGTGGAGTAGGAGAAGGG - Intergenic
993604278 5:89969031-89969053 CATGGGAATGAACAGTAGAAGGG + Intergenic
993809638 5:92459393-92459415 CAGGGGAAGGAGGAGAGGAAGGG - Intergenic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994186537 5:96821512-96821534 CAGGGGGAAGCACAGGATAAAGG + Intronic
994412820 5:99431039-99431061 AAGGGAAATCAGCAGGAGAACGG - Intergenic
994481021 5:100334681-100334703 AAGGGAAATCAGCAGGAGAACGG + Intergenic
994606691 5:101976267-101976289 CAAGGTAAAGAGAAGGATAATGG + Intergenic
994773548 5:104014469-104014491 CAGGTTACAGAGCAAGAGAATGG - Intergenic
995155312 5:108904429-108904451 CAGTGGGAAGAGCAGATGAAAGG + Intronic
995173036 5:109139453-109139475 AAGGAGAAGTAGCAGGAGAATGG - Intronic
995243791 5:109914915-109914937 CTGGTGTAAGAGCAGAAGAAGGG - Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995511856 5:112918510-112918532 GAGAGGAAACAGCAAGAGAAAGG + Intronic
995844318 5:116477693-116477715 AATGGGAAAGGGTAGGAGAAAGG + Intronic
995984075 5:118147031-118147053 CCGGGGAAAGAGGAAGGGAAAGG - Intergenic
996074528 5:119174781-119174803 TAGAGGAAAGAGAAAGAGAAAGG - Intronic
996382739 5:122878318-122878340 CAGGAGAATGAGGTGGAGAAGGG + Intronic
996641149 5:125755221-125755243 CAGTGAAAAGAGCATTAGAAAGG + Intergenic
996678831 5:126208024-126208046 CAAGGGAAAGGGCAGGAGGCAGG + Intergenic
996801271 5:127406284-127406306 CAGGGGCCAGAGAAAGAGAAGGG + Intronic
996847923 5:127921120-127921142 GAGAGGAAAGGACAGGAGAAAGG + Intergenic
997265353 5:132491675-132491697 TAGGGAACAGAGGAGGAGAAGGG + Intergenic
997480930 5:134184080-134184102 CAGGCCATAGAGCAGGAAAATGG + Intronic
997594991 5:135101315-135101337 TAAGGGAAAGTTCAGGAGAAGGG - Intronic
997786110 5:136715500-136715522 GAGGGGAAGGGGCAGGAGCAGGG - Intergenic
997823837 5:137089048-137089070 AAGGGGGCTGAGCAGGAGAATGG + Intronic
998072330 5:139207760-139207782 CAGGGGTAAGAGCTGGGGAGTGG + Intronic
998139714 5:139693022-139693044 TGGGTGGAAGAGCAGGAGAAGGG - Intergenic
998163640 5:139827974-139827996 GAGGTGGAAGAGCAGGAGATGGG + Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998374363 5:141681405-141681427 CAAGGGAATGAGCAGGGAAAAGG - Intronic
998510952 5:142713518-142713540 CCTGGGAAACAGGAGGAGAACGG - Intergenic
998842886 5:146274934-146274956 GAGAGGGAAGAGCAGGTGAAAGG - Intronic
999084183 5:148872642-148872664 AAGGAGAAAGAGCATGAGATCGG + Intergenic
999236209 5:150097311-150097333 AAGGGGAAGGGGAAGGAGAAGGG + Intronic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
999483790 5:151972709-151972731 CAGGGGAAAGAATGAGAGAAAGG + Intergenic
999779615 5:154838701-154838723 CAGGAGGCTGAGCAGGAGAATGG - Intronic
999904443 5:156124091-156124113 CAGGGAAAGGGGGAGGAGAAAGG - Intronic
1000009443 5:157217747-157217769 CAGGGAAAACAACAGAAGAAAGG - Intronic
1000113848 5:158135146-158135168 GAGGGGATGGGGCAGGAGAAAGG + Intergenic
1000113866 5:158135203-158135225 GAGGGGATGGGGCAGGAGAAAGG + Intergenic
1000151307 5:158503895-158503917 CAGGGGAGAGAGCTGGAGGTAGG + Intergenic
1000240839 5:159406678-159406700 CTGGGGATAGAGTAGGAGCACGG - Intergenic
1000537132 5:162493126-162493148 CAGGAGAAATAGCATGGGAATGG + Intergenic
1000598806 5:163247688-163247710 CGGGGGAAAGAACAGTACAAAGG + Intergenic
1000601349 5:163278997-163279019 AAGAGGAAAGAACCGGAGAAGGG + Intergenic
1000713994 5:164617595-164617617 CAGGAGAAATAGCAGGAAAAGGG + Intergenic
1001087890 5:168714762-168714784 CAGGGAGAAGGGGAGGAGAAAGG - Intronic
1001106717 5:168860786-168860808 CAGGGGAAACAGCTTAAGAATGG - Intronic
1001138611 5:169123980-169124002 GAGAGGAATGAGCAGGAGCATGG - Intronic
1001233960 5:170013947-170013969 AAGGGGAAATAGCTGTAGAATGG + Intronic
1001265254 5:170269408-170269430 CAGGGAAAAGGGTAGGAGCAAGG + Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001468482 5:171990142-171990164 AAGGGGAAAGAGGAAGAGAAGGG + Intronic
1001551201 5:172603423-172603445 CGGGGGAAAGAGCTGAGGAAAGG - Intergenic
1002190664 5:177475815-177475837 CAGGGGCAACAGCAGCTGAAAGG - Intergenic
1002439286 5:179256021-179256043 CTGGGGACAGAGAAGGAGACTGG - Intronic
1002592580 5:180301033-180301055 GAGAGGAAAGAAAAGGAGAAAGG + Exonic
1002811908 6:639261-639283 CAGTGGCAAGGGCAGGAGAAGGG - Intronic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003756576 6:9127838-9127860 CAGAGCAAAGAGGATGAGAAAGG - Intergenic
1004061710 6:12204381-12204403 CGGGGGAAAGGGAGGGAGAAAGG - Intergenic
1004180161 6:13374406-13374428 AAGGAGACTGAGCAGGAGAATGG - Intronic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004302063 6:14467546-14467568 GAGGAGGAAGAGGAGGAGAAAGG - Intergenic
1004608768 6:17218900-17218922 CAGGGCAGTGAGCAAGAGAAAGG - Intergenic
1004617408 6:17303605-17303627 AAGGGAAAAGGGAAGGAGAAGGG + Intergenic
1004721030 6:18267209-18267231 GAGGGGAAAGTGCAGGAGGTGGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005258151 6:24026942-24026964 AAGGGGAAGGAGCAGGAAATAGG - Intergenic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005695798 6:28351622-28351644 AAAGGGAAGGAGGAGGAGAAGGG - Intronic
1005758438 6:28946342-28946364 GAAGGAAAAGAGCAAGAGAATGG + Intergenic
1005763267 6:28987029-28987051 CAGGAGAAAGAGCAGGGGGGCGG + Intergenic
1005792700 6:29322408-29322430 CAGGGGAAAGGGTGGGAGCAGGG - Intergenic
1005840531 6:29742250-29742272 CTGGGGAAAGAGGGAGAGAAAGG - Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006021754 6:31121522-31121544 CAGGGGCCAGAGCAGGAGGGAGG - Intronic
1006053185 6:31359285-31359307 GAGGACAAGGAGCAGGAGAAAGG - Intergenic
1006081937 6:31572839-31572861 CAGGTGAGGCAGCAGGAGAATGG + Exonic
1006180749 6:32152077-32152099 CCGGGGTAAGAGGAGGAGAGAGG - Intronic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006200644 6:32286893-32286915 CAGGGCAAAGAGATAGAGAATGG + Intergenic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1006846756 6:37067550-37067572 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1006972441 6:38060506-38060528 AAGGGGAAAGGGCAGGGCAAGGG - Intronic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007772648 6:44203474-44203496 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1007781920 6:44259278-44259300 CAAGGGACTGAGAAGGAGAATGG + Exonic
1007864710 6:44955721-44955743 CAGGGGAAAGGGTAGGAGGGGGG + Intronic
1008035254 6:46738434-46738456 AAGGGGTAGGAGCAGGAGTAAGG + Intergenic
1008624920 6:53306189-53306211 CCGTGGAAAGGGGAGGAGAAAGG + Intronic
1008793028 6:55262109-55262131 CAGGGGAAAGTGAGGGAGAGGGG + Intronic
1008839933 6:55890537-55890559 CAGGGGAAAGAGCTGAGGATGGG + Intergenic
1009484476 6:64202752-64202774 AAGAGGAAAGAGAAGGGGAAAGG + Intronic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010562352 6:77366204-77366226 CAAGGGAAGGAGCAAGAGAGAGG - Intergenic
1010754207 6:79648390-79648412 CAAAGGAAATAGCATGAGAAAGG - Intronic
1010824135 6:80452118-80452140 GAGGGGAGAGAGCAAGAGAGAGG + Intergenic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1010835959 6:80587532-80587554 CAGGCAAAAGAGCACGAGCAAGG - Intergenic
1010966376 6:82213868-82213890 GAGGGGAAGGAGAAAGAGAAGGG + Intronic
1010974406 6:82296238-82296260 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
1010977523 6:82332543-82332565 GAGGGGATAGAGAAGAAGAAGGG - Intergenic
1011484740 6:87829942-87829964 GAGGAGGAAGAGGAGGAGAAGGG - Intergenic
1011484769 6:87830052-87830074 GAGGAGGAAGAGGAGGAGAAGGG - Intergenic
1011484776 6:87830079-87830101 GAGGAGGAAGAGGAGGAGAAGGG - Intergenic
1011739228 6:90342828-90342850 CAGGAGGCTGAGCAGGAGAATGG - Intergenic
1011789186 6:90879637-90879659 TAGGGGGAAGAGTGGGAGAAGGG - Intergenic
1011791797 6:90906966-90906988 CTGTGGAAAGAGAAAGAGAAAGG - Intergenic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012204631 6:96445304-96445326 TAGGGGAAAGGGTAGGAGGAAGG + Intergenic
1012258416 6:97060548-97060570 CCGGTGAAAGAGGAGGAGAATGG - Intronic
1012437918 6:99234776-99234798 CAGCTGAAGGAGCAGGAGAAGGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1013153257 6:107467356-107467378 AAGGGGAAAGGGATGGAGAAAGG - Intergenic
1013460508 6:110370861-110370883 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1013904291 6:115197620-115197642 CAGGAGAGAGAGCGAGAGAAGGG + Intergenic
1013945504 6:115717628-115717650 CAGGGGAAAAAGAAGAACAATGG + Intergenic
1014092763 6:117423155-117423177 TAGGGGAAAGAGTGGGAGCAGGG + Intronic
1014383750 6:120776701-120776723 GAGGGAAAAGAGGAGGTGAAGGG - Intergenic
1014476391 6:121877596-121877618 GAGGAGAAAGAAGAGGAGAAGGG + Intergenic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014899885 6:126950053-126950075 AAGGGGAAAGAAAAGGGGAAGGG - Intergenic
1015126885 6:129764863-129764885 CAGAGGAAAGAGGGAGAGAAAGG + Intergenic
1015199809 6:130566537-130566559 GAGGAGAAAGAGCAAGAGCAAGG + Intergenic
1015434965 6:133174725-133174747 AAGGGGAAGGGGAAGGAGAATGG - Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015601010 6:134910491-134910513 CAGAGGAAGGGGCAGGAGAGGGG - Intergenic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016389336 6:143559372-143559394 CTGAGGAAATATCAGGAGAAAGG + Intronic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016531715 6:145065689-145065711 CAGGGAAAAGAGGAGGAGTTTGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016920518 6:149288796-149288818 GAGGGGCAAGAGCAGAAGCAGGG - Intronic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339578 6:153305237-153305259 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017339611 6:153305357-153305379 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1017339618 6:153305375-153305397 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339633 6:153305435-153305457 TAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1017503743 6:155048531-155048553 AAGAGGACAGAGCAAGAGAAGGG + Intronic
1017573205 6:155771035-155771057 AAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1017969049 6:159294705-159294727 CAGAAGAAATAGCTGGAGAAGGG + Intergenic
1018090318 6:160340888-160340910 CAGAGAAAAGCCCAGGAGAATGG - Intergenic
1018152623 6:160954607-160954629 GAAGGGAAAGAGGAGGAGAAGGG - Intergenic
1018391138 6:163342940-163342962 CAGGGAAAGGAGCTAGAGAAAGG - Intergenic
1018646279 6:165951679-165951701 CAGAGGACAGTGCTGGAGAACGG - Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018839456 6:167507925-167507947 GAGGGGACAGGGCAGGAGAGGGG - Intergenic
1018839609 6:167508296-167508318 GAGGGGACAGGGCAGGAGAGGGG - Intergenic
1018839727 6:167508622-167508644 GAGGGGACAGGGCAGGAGAGGGG - Intergenic
1018911486 6:168102843-168102865 CAGAAGGAAGAGGAGGAGAAGGG - Intergenic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019880607 7:3857279-3857301 AAGGGGAAGGAGGAGGAGAAAGG + Intronic
1019969601 7:4529567-4529589 CAGGAGCAGGAGCAAGAGAAAGG + Intergenic
1020402346 7:7793399-7793421 TAGTGGAAAGAACAGGGGAATGG - Intronic
1020642102 7:10768241-10768263 CTGGGATAAGACCAGGAGAATGG - Intergenic
1021083071 7:16386292-16386314 CAGACAAAAGAGCAGCAGAATGG - Intronic
1021098779 7:16564072-16564094 GAGGGGAAAGAGAAGACGAAGGG + Intronic
1021101082 7:16586500-16586522 CAGGGGACAGAGCACAGGAAAGG - Intergenic
1021128342 7:16880497-16880519 GAGGGGAAAGAGGAGGGGAAAGG - Intronic
1021132687 7:16930153-16930175 AAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1021313246 7:19117433-19117455 CGGAGGAGAGAGCAGGAGGACGG + Exonic
1021381502 7:19972745-19972767 AAGGGGAAAGAGAAGTATAATGG + Intergenic
1021479461 7:21100096-21100118 CAGGGGAAAGAGTAGGATTGTGG - Intergenic
1021517868 7:21507042-21507064 AAGGGGAATGATCAGGAGAGTGG - Intronic
1021600974 7:22362829-22362851 CAGGGGATAGAGGAGTAGCAGGG + Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022100031 7:27164067-27164089 AAGAGGACAGAGTAGGAGAAAGG - Intronic
1022274420 7:28841811-28841833 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1022274423 7:28841817-28841839 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1022274434 7:28841841-28841863 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
1022357052 7:29625786-29625808 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1022360866 7:29655888-29655910 CAGGGGCTGAAGCAGGAGAATGG + Intergenic
1022822942 7:33979286-33979308 CAGGTGAACAAGCAGAAGAAAGG - Intronic
1023060176 7:36319174-36319196 AAGGGAGAAGAGCGGGAGAAGGG + Intergenic
1023158758 7:37277536-37277558 AAGAGGGAAGAGCAGGAGTAAGG + Intronic
1023718826 7:43072288-43072310 AAGAGGACAGAGGAGGAGAAAGG + Intergenic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023811697 7:43916970-43916992 GAGAGGACAGAGGAGGAGAAAGG - Intronic
1024134204 7:46390047-46390069 CTGGGGAAAGAGTTGGAGAGAGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024499731 7:50092328-50092350 TAGGGGATAGGGGAGGAGAAAGG - Intronic
1024875718 7:54020714-54020736 CGGGGGAAAGAGTGGGAGGAGGG - Intergenic
1024883100 7:54111807-54111829 CAGGGAAAAGGGAAGGAAAAGGG + Intergenic
1025110360 7:56211452-56211474 AAGGGGAGAGGACAGGAGAAGGG + Intergenic
1025232092 7:57209408-57209430 CAGGTGAAATAGAAAGAGAAGGG + Intergenic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1025873098 7:65453344-65453366 CAGGGGAAAATGGAGTAGAAGGG + Intergenic
1026205742 7:68255669-68255691 GAGGAGAAAGAAAAGGAGAAAGG - Intergenic
1026228364 7:68462663-68462685 CTGGGGAAAGAGGAGGGGAGGGG - Intergenic
1026800599 7:73397737-73397759 AAGGGGGAAGAAAAGGAGAAGGG + Intergenic
1026800605 7:73397755-73397777 AAGGGGGAGGAGAAGGAGAAGGG + Intergenic
1026800611 7:73397773-73397795 AAGGGGGAGGAGAAGGAGAAGGG + Intergenic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1027396998 7:77767019-77767041 AAGGGGAAAGGGAAGGGGAAGGG - Intronic
1027397011 7:77767048-77767070 AAGGGGAAAGGGAAGGGGAAGGG - Intronic
1027421805 7:78024156-78024178 TAGGATAAAAAGCAGGAGAATGG - Intronic
1027755818 7:82210792-82210814 AAAGGGAAACAACAGGAGAATGG - Intronic
1027838921 7:83281837-83281859 CAGAGGAAAGATCTGGAGAAAGG - Intergenic
1028611524 7:92717368-92717390 AAGGGGAAGGAGAAGGGGAAAGG + Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1028999643 7:97139515-97139537 CAGAGGAAAGAGCACCAGACAGG + Intronic
1029002905 7:97174346-97174368 CAGGGGAAGTAGCTGCAGAAAGG - Intronic
1029308780 7:99641862-99641884 CAGAGGAAAGAGTAGAAGCAGGG - Intergenic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029432455 7:100539739-100539761 GAGGGGAAAGGGCAGGGGAGAGG + Intronic
1029451038 7:100641879-100641901 GAGGGGTAAAAGCAGGAGAGGGG - Intronic
1029593167 7:101520726-101520748 CTGGGGAAGGAGCATGAGAGGGG - Intronic
1030014950 7:105209613-105209635 AAGGGGAAAGAAAAGGGGAAGGG + Intronic
1030153529 7:106429050-106429072 CAGGGCAAGAAGCAGGAGTATGG - Intergenic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1030845231 7:114400972-114400994 AAGAGGAAATAGCAGGAGTAAGG + Intronic
1031101036 7:117479909-117479931 CGGGGGAAAGAGCAAAAGGAAGG + Intronic
1031865986 7:127039618-127039640 AAGGGGAAGGGGAAGGAGAAGGG + Intronic
1031865989 7:127039624-127039646 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1031878651 7:127170836-127170858 CAGGGGAAAGGGTGGGAGAAGGG + Intronic
1031912488 7:127532736-127532758 AAGGGGAAAGGGAAGGGGAAGGG + Intergenic
1031924854 7:127629554-127629576 AAGGGGAAACAGCACTAGAAGGG + Intergenic
1031997944 7:128245233-128245255 CAGGGGAAAGAGGGGAAGCAGGG - Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032418648 7:131759490-131759512 CTGGAGAAAGAGCAGGGGAAAGG - Intergenic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1032517161 7:132515205-132515227 CAGGGGTGAGAGCAGGGGACAGG + Intronic
1032630421 7:133645010-133645032 CAGGTGAAGGAGGAGGAAAAGGG - Intronic
1032653160 7:133900674-133900696 CAGGGGACAGGGAAGGAAAATGG + Intronic
1032790829 7:135241332-135241354 CAGGCCAAAGAGGAGGTGAAGGG - Intronic
1032911800 7:136440855-136440877 CAGGGGAAATGGTGGGAGAAGGG - Intergenic
1032945694 7:136849748-136849770 CAGGGGAAGGAGGAGAAGACAGG + Intergenic
1032948713 7:136882427-136882449 AGGGGGAAGGAGGAGGAGAAAGG - Intronic
1033321450 7:140343392-140343414 CAGGTGAGAGAACAGGAGAGGGG - Exonic
1033359198 7:140626234-140626256 CAGGGGACGGAGAAGGGGAAGGG - Intronic
1033399270 7:141006436-141006458 AAGGGAAAAGAGCAGCAAAAAGG - Exonic
1033400726 7:141021532-141021554 CAGGGGGAAGGGCAGGAGTGGGG - Intergenic
1033414091 7:141147228-141147250 AAGGAGAAAGGGAAGGAGAAAGG - Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033804336 7:144937446-144937468 AAGGAGAAAGGGAAGGAGAAAGG - Intergenic
1033804339 7:144937458-144937480 AAGGAGAAAGGGAAGGAGAAAGG - Intergenic
1033804353 7:144937506-144937528 AAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1033804381 7:144937562-144937584 AAGGGGAAGGGGAAGGAGAAAGG - Intergenic
1033804384 7:144937574-144937596 AAGCGGAAAGAGAAGGGGAAGGG - Intergenic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1033961083 7:146913900-146913922 CAGGGGAAAGGGTAGGAGGGTGG - Intronic
1034142692 7:148836977-148836999 TAGAGGGAAGAGCAGGTGAATGG + Intronic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034562507 7:151890311-151890333 CAGGAGAAGGAGCAGAGGAAGGG - Intergenic
1034579551 7:152030837-152030859 GAAGGGAAAGACCAGCAGAAAGG - Intronic
1034702873 7:153111437-153111459 CAGGGGACAGAGGAGGCGCAGGG + Intergenic
1034822970 7:154234173-154234195 TAGAGGAAACAGCAGGAAAAAGG + Intronic
1034846514 7:154451253-154451275 CAGGAGGCTGAGCAGGAGAATGG + Intronic
1034859063 7:154580871-154580893 CAGAAGAAAGAGCAGCAAAAAGG + Intronic
1035057537 7:156046097-156046119 CAGGAGCAGGAGCAGGAGAGAGG + Intergenic
1035161151 7:156950608-156950630 CAGGGGGAAGAAAAGGAAAAGGG + Exonic
1035237678 7:157509233-157509255 GAGGGGGGAGAGAAGGAGAAGGG + Intergenic
1035287724 7:157816860-157816882 AAGAGAAAAGAGGAGGAGAAAGG - Intronic
1035338390 7:158144637-158144659 AAGGGGAAGGGGAAGGAGAAGGG + Intronic
1035435865 7:158858852-158858874 CAGGGGAAAGGGGAGGGGAGAGG - Intronic
1035476146 7:159145183-159145205 CAGGGAAGAGGGGAGGAGAACGG - Intergenic
1036098779 8:5754983-5755005 CAAGAAAATGAGCAGGAGAATGG + Intergenic
1036163081 8:6406866-6406888 CGGGGGAGAGAGCAGGAGCAGGG - Intronic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036445998 8:8822397-8822419 CAGGGGATGGAGCGGGAGACAGG + Intronic
1036481651 8:9145308-9145330 GAGGAGGAAGAGGAGGAGAAGGG - Intronic
1036495038 8:9262635-9262657 CTGAGGCAGGAGCAGGAGAATGG - Intergenic
1036548237 8:9792594-9792616 AAGGGGAAAGAGAAAGGGAAAGG + Intergenic
1036634362 8:10538738-10538760 CAGGGGACAGAGCAGGAGCCAGG - Exonic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036718035 8:11144882-11144904 AAGGGGAAGGGGAAGGAGAAGGG + Intronic
1036718038 8:11144888-11144910 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1037130395 8:15401862-15401884 AAGGTGAAAGAGAAGCAGAATGG + Intergenic
1037432934 8:18832774-18832796 CAGGCAAAAGAGCAGGTGCAGGG + Intronic
1037599471 8:20381770-20381792 GAGGGGACAGGGCTGGAGAACGG - Intergenic
1037738522 8:21586052-21586074 CAGGGGAGAGGTCAGGGGAAGGG + Intergenic
1037823641 8:22147868-22147890 CAGGGGGCAGAGCATGGGAAAGG + Exonic
1037942539 8:22963201-22963223 CATGGGAAAGAAGAGGGGAAAGG + Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1038166312 8:25088086-25088108 AAGGGGAAAGGGAAGGGGAAAGG + Intergenic
1038166317 8:25088098-25088120 AAGGGGAAAGGGAAGGGGAAAGG + Intergenic
1038190803 8:25318524-25318546 GAGGGGGAAGGGGAGGAGAAGGG - Intronic
1038319939 8:26516745-26516767 CAGGGGAAGGTGCTGCAGAAAGG - Intronic
1038378896 8:27073652-27073674 CAGTGGAAAGAGCAGGAACTTGG + Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1039247810 8:35628974-35628996 CAGAGGAAAGAGCACCAGAGAGG - Intronic
1039986307 8:42451213-42451235 GAGGGGGATGAGGAGGAGAAAGG + Intronic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040813859 8:51485610-51485632 CAGAGGAAACATTAGGAGAAAGG - Intronic
1041023694 8:53662365-53662387 CAGGGGGAAGAGGAGGAAATTGG + Intergenic
1041305054 8:56449019-56449041 CAGGGGAGAGAGAAACAGAAAGG + Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1041586773 8:59529834-59529856 GAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1041683096 8:60613267-60613289 CATGGGGAACAACAGGAGAAGGG - Intronic
1041868147 8:62600361-62600383 CAGGGGACAGGGGAGGAAAATGG + Intronic
1041926804 8:63245446-63245468 CAGGGGAAAGGGTAGGAGAGGGG - Intergenic
1042047427 8:64669438-64669460 CAGGGGCAGGGGCAGGAAAAAGG + Intronic
1042301016 8:67281089-67281111 CACTGGAAAAAGCAGTAGAATGG + Intronic
1042399826 8:68332012-68332034 CAGGAGAAAGGGACGGAGAAAGG + Intronic
1042470141 8:69178131-69178153 CCGGGGCAAGAGCTGGAGAATGG + Intergenic
1042769949 8:72368626-72368648 CAGGAAAGAGAGCAAGAGAAGGG - Intergenic
1042917369 8:73888844-73888866 CAAGGGAAGAATCAGGAGAAAGG + Intergenic
1043185050 8:77138000-77138022 AAGGGGGAAGAGAAAGAGAAAGG - Intergenic
1043339297 8:79218202-79218224 GAGGGGAAATAGCAGAAGATTGG + Intergenic
1043368765 8:79566161-79566183 CAGTGGAAAGAACAAGAGCAAGG - Intergenic
1043458037 8:80431602-80431624 CAGGGGAATGAGTTGCAGAAAGG + Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1044152548 8:88799783-88799805 CAGGAGAGAGAGCAAGAGCAGGG - Intergenic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402234 8:91786155-91786177 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1044728553 8:95212532-95212554 CAGGGGAAGGAGCAGGTGAGGGG + Intergenic
1044743004 8:95346849-95346871 AAGGGGAAAGGAAAGGAGAAAGG - Intergenic
1044983270 8:97736430-97736452 GAGGGGGAGGAGAAGGAGAAAGG + Intergenic
1045011086 8:97958890-97958912 CAGGGGAAGTAGCAGAAGAGAGG - Intronic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045718278 8:105074482-105074504 CAGTGGACAGAGCAGGAAAGGGG + Intronic
1046430113 8:114113597-114113619 CAGGGGGAAGAGTAGCAGAGCGG - Intergenic
1046742388 8:117843470-117843492 CAGGGGTAAGAGGAGGTGATGGG + Intronic
1047321188 8:123785272-123785294 GACAGGAAAGAGCAGGAAAAGGG + Intronic
1047444525 8:124907328-124907350 AAGGGGAACGGGAAGGAGAAGGG + Intergenic
1047444530 8:124907380-124907402 CAAGGGAAAGACCAGCAGAGAGG + Intergenic
1047523727 8:125615292-125615314 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1047531081 8:125676013-125676035 CTAAGGAAACAGCAGGAGAATGG + Intergenic
1047544464 8:125802480-125802502 AGGGGGAGAGAGAAGGAGAAGGG + Intergenic
1047701386 8:127452683-127452705 GAGGAGGAAAAGCAGGAGAAAGG + Intergenic
1047747775 8:127857567-127857589 TAGGTGAAAGAGGAGGAGATGGG + Intergenic
1047811517 8:128414905-128414927 CAGGGGAAGGAGAAAGTGAAGGG + Intergenic
1047998850 8:130359948-130359970 CAGGGGTAAGAACCAGAGAACGG - Intronic
1048010749 8:130453744-130453766 CAGGGGAATGAGGAAGGGAAAGG + Intergenic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048090057 8:131230180-131230202 CATGGGAGAAACCAGGAGAAGGG + Intergenic
1048115531 8:131517644-131517666 GAGAGGAAAGAACAGGAGAAAGG - Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048904364 8:139073615-139073637 AAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1048978102 8:139684558-139684580 CAGGGGAAAAAGAAGGCAAAAGG + Intronic
1049108772 8:140629876-140629898 CAGGGGGAAGAGGAGGGGAGGGG + Intronic
1049287479 8:141783660-141783682 AATGGGAAACAGCAGGAGAAGGG + Intergenic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049461604 8:142732069-142732091 CAGGGGAAGGGGAAGGAGAGGGG - Intronic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1049997850 9:1048229-1048251 GAGGAGAAACAGGAGGAGAAAGG - Intergenic
1050416361 9:5421399-5421421 GAGGGGAAAAAGCAGGGTAAGGG - Intronic
1050629475 9:7543461-7543483 CATGGGAGAGAGGGGGAGAAAGG - Intergenic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051059971 9:13034464-13034486 GAGGGGAAACAGCAGAAGAATGG - Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051593980 9:18805667-18805689 CAGGGGCAGGGGCAGGAGAAAGG - Intronic
1051811432 9:21054084-21054106 CAGGAGAAAGAGAGAGAGAAAGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052059353 9:23941897-23941919 GAGAGGAAAGAGGAGGAAAAAGG + Intergenic
1052276820 9:26686005-26686027 CAGGGGTCAGAGCAGATGAATGG + Intergenic
1052717448 9:32134128-32134150 TAGCTGCAAGAGCAGGAGAATGG - Intergenic
1052764687 9:32629377-32629399 CAGGGGAAATGGTAGGAAAATGG - Intergenic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1053000895 9:34576926-34576948 CTGCAGAAAGGGCAGGAGAAGGG + Intronic
1053215769 9:36269251-36269273 AAGGGGCAAGAGGAGGAGTAGGG - Intronic
1053306489 9:36987709-36987731 CATGGGGAAGAGCAGGAAAGGGG + Intronic
1053377979 9:37624336-37624358 CAGGGCACACAGCAGGAGACAGG + Intronic
1053632183 9:39954811-39954833 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
1053773582 9:41508724-41508746 ATGGGGAAAGAGAAGGAGATTGG + Intergenic
1054211705 9:62295887-62295909 ATGGGGAAAGAGAAGGAGATTGG + Intergenic
1054313277 9:63552942-63552964 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055410750 9:76026929-76026951 CAGAGGAGAGAGCAAGGGAAAGG - Intronic
1055457555 9:76487216-76487238 CAAGGGAAGGAGCAGGAAACAGG - Intronic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055954231 9:81759222-81759244 CAGAGGAAAGAAAAGGGGAAAGG - Intergenic
1056063209 9:82906509-82906531 TAGGAGAAAAAGAAGGAGAAGGG + Intergenic
1056146103 9:83730895-83730917 AAGGAGAAAGAGGAGGAGAAGGG + Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056578473 9:87873156-87873178 AAGGGGAAGGAGGAGGAGAGAGG + Intergenic
1056935766 9:90913921-90913943 CTGGGGAATGGGCAGGTGAAAGG + Intergenic
1057115969 9:92522498-92522520 ATGGGGAAAGAGAAGGAGAGAGG - Intronic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1058110627 9:101028348-101028370 CAGGGTAGAAAGCAAGAGAATGG + Intergenic
1058223521 9:102332043-102332065 GAGGGGGAAGAGCAATAGAAGGG - Intergenic
1058297183 9:103324007-103324029 AAGGGGAAGGGGAAGGAGAAAGG - Intergenic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058637324 9:107049285-107049307 CAGTGGACAGTGCAGGAGGAGGG - Intergenic
1058674862 9:107391584-107391606 TAGGAGAAAGAGCAGTGGAAAGG - Intergenic
1058873050 9:109218850-109218872 CATGGGAATGAGCAGAAAAAGGG - Intronic
1058901542 9:109446629-109446651 CTGGAGAAAGAGGAGGTGAATGG + Intronic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059730289 9:117050450-117050472 CAGGGGAGGAAGCAGGAGTAGGG - Intronic
1059788450 9:117612962-117612984 GAGGAGAAAGAGGAGGAGAAGGG + Intergenic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1060702114 9:125764160-125764182 CAGGGGGAGGGGCAGGAAAAAGG - Intronic
1060723395 9:125992653-125992675 TGGGGGACAGAGCGGGAGAAGGG + Intergenic
1060741729 9:126103201-126103223 CAGAGGAGAGAGCAGGTGGAAGG - Intergenic
1060802108 9:126551406-126551428 CAGGGGCAGGGGCAGGGGAAGGG - Intergenic
1060889943 9:127181738-127181760 CAGGCCAAAGAGATGGAGAAAGG - Intronic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061366903 9:130176947-130176969 CATGGGGAGGAGAAGGAGAAGGG - Intronic
1061439012 9:130586853-130586875 CAGGAGGCTGAGCAGGAGAATGG - Intronic
1061864613 9:133485842-133485864 CAGGAGGAACAGCAGGACAAGGG - Intergenic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062154499 9:135039129-135039151 CAGGGGAGGGAGCAAGAGAGAGG - Intergenic
1062194136 9:135263891-135263913 GAGGGGAAGGAGGAGGAGAGGGG - Intergenic
1062205730 9:135335849-135335871 CAGGGGCCAGAGCAGGTGCAGGG + Intergenic
1062386044 9:136311901-136311923 TGGGGGACAGAGCAGGGGAAGGG + Intergenic
1062456180 9:136640280-136640302 CAATGGGAAAAGCAGGAGAACGG - Intergenic
1203768183 EBV:37235-37257 CCGGGGACAGAGCAGGGGGAGGG + Intergenic
1203779992 EBV:95963-95985 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203779998 EBV:95981-96003 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780016 EBV:96026-96048 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780022 EBV:96044-96066 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780036 EBV:96080-96102 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780042 EBV:96098-96120 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780052 EBV:96125-96147 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780066 EBV:96161-96183 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780072 EBV:96179-96201 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780082 EBV:96206-96228 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780096 EBV:96242-96264 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780120 EBV:96308-96330 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780176 EBV:96461-96483 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780186 EBV:96488-96510 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780223 EBV:96587-96609 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203531531 Un_GL000213v1:147580-147602 CAGGAGGCTGAGCAGGAGAATGG - Intergenic
1185537383 X:872962-872984 GAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1185566605 X:1099730-1099752 CAGGAGAAGGAGTAGGTGAAGGG + Intergenic
1185591607 X:1281052-1281074 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
1185591619 X:1281096-1281118 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
1185754624 X:2643431-2643453 AAAGGGAAAGAGGAGGAGAAGGG + Intergenic
1185820126 X:3194897-3194919 CAGGAGAGAGAGCAAGAGCAGGG - Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1186208345 X:7223978-7224000 TAGTTGAAAGAGAAGGAGAAAGG + Intronic
1186424839 X:9455700-9455722 AAGTAGAAAGAGAAGGAGAAAGG - Intergenic
1186806669 X:13146662-13146684 CAGGGGAAGGAGCAAGCCAAGGG - Intergenic
1187356121 X:18573581-18573603 CAGGGAAAAGAGCATGACAGTGG - Intronic
1187447668 X:19373130-19373152 CAGGGGAAGGAGGAAGAGAGAGG + Intronic
1187576216 X:20559140-20559162 GAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1187576224 X:20559173-20559195 CAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1187598185 X:20798056-20798078 CAGGGAAAAGGGCAAGAGAGGGG - Intergenic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1187708997 X:22035283-22035305 GAGGGGAAGGAGAAGAAGAAAGG - Intronic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1188033336 X:25289151-25289173 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1188079231 X:25815553-25815575 CAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1188113373 X:26217044-26217066 CAGGAGAATGAGTAGGAGAACGG - Intronic
1188680930 X:33003137-33003159 CAGGGGGAAGGGTAGGAGATGGG - Intronic
1188862423 X:35272855-35272877 GAGAGGACAGAGGAGGAGAAAGG + Intergenic
1189135663 X:38546876-38546898 TAGAGGAAAGAGGAGGAAAAGGG + Intronic
1189289084 X:39872693-39872715 GAGGAGAAAGAGAAGAAGAAGGG - Intergenic
1189426984 X:40910555-40910577 CAAGAGACAGAGCAAGAGAAAGG + Intergenic
1189524506 X:41805636-41805658 AAGGGGAAAGAGAAAGGGAAGGG + Intronic
1190029016 X:46953909-46953931 CAGGAGAGGGAGGAGGAGAAAGG - Intronic
1190411552 X:50141424-50141446 CATGAGAAAGTGCAGGAAAAGGG + Intergenic
1190561936 X:51694944-51694966 AAGGGGAAGGGGAAGGAGAAAGG + Intergenic
1190561950 X:51694980-51695002 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1190575507 X:51832607-51832629 GAGGGGAAAGAGAAGGGAAAAGG + Intronic
1190598176 X:52066740-52066762 GAGGGGAAAGAGGAGAAGAGAGG + Intronic
1190610648 X:52187333-52187355 GAGGGGAAAGAGGAGAAGAGAGG - Intronic
1190894965 X:54608500-54608522 CGGGGGAAAGAGTAGGAGGGGGG - Intergenic
1190925122 X:54896269-54896291 CAGGGGAGAGGGAAAGAGAAAGG - Intergenic
1191099598 X:56711461-56711483 CAGGTGAAAGAGTGGGAGCAGGG + Intergenic
1191142993 X:57135458-57135480 CAGGGGAAGGAACAAGAGATTGG - Exonic
1191819282 X:65285265-65285287 CAAGGGAAAGGGTGGGAGAAGGG - Intergenic
1191901377 X:66044093-66044115 CAGTGGAAAGAGCATGGGAATGG + Intergenic
1192005304 X:67205374-67205396 CAGGGGAAAGTGAAGCATAATGG + Intergenic
1192239930 X:69320871-69320893 CAGGGGAAAGACCTGGAGGCTGG - Intergenic
1192432091 X:71119264-71119286 AAGGTGAAAGGGCAGGAGGAGGG - Intronic
1192478555 X:71464984-71465006 CAGGGGAAATGGTAGGAAAATGG + Exonic
1192669525 X:73125223-73125245 GAGGTGAAAGAGGAGGAGTATGG - Intergenic
1192781944 X:74303570-74303592 CAGGGGACAGAGCAAGATCATGG + Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193255863 X:79348451-79348473 CAGGGGAAAGGGTGGGAGTAGGG + Intergenic
1193640049 X:84001746-84001768 AAGGGGAAAGGGCAGGATATTGG - Intergenic
1193945100 X:87724684-87724706 CAGGGGTAAGTGAAGGAGAGAGG + Intergenic
1194178222 X:90679221-90679243 AAGGAGAAAGAGAAGGAAAAGGG - Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196650046 X:118159286-118159308 AAGGGGAGAGAGAAAGAGAAAGG + Intergenic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1197392546 X:125884719-125884741 CAGGTGACAGAGCAAGTGAAGGG - Intergenic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1197446229 X:126553996-126554018 CAGTGGGAAGAGCAGGCGAGTGG + Intergenic
1197545774 X:127822189-127822211 CAGGGGAAAGGGAGGGAGTAGGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197765153 X:130055412-130055434 CAAGAGTAAGAACAGGAGAAGGG + Intronic
1198075098 X:133186339-133186361 CAGGGAAAGGAGCAGGAAAGAGG + Intergenic
1198308215 X:135403358-135403380 AAGGGGAGAGAGGAAGAGAAGGG - Intergenic
1198466740 X:136910210-136910232 GAGGGGAAAGAGAAGGAGATGGG - Intergenic
1198972817 X:142300511-142300533 TATGGAACAGAGCAGGAGAAAGG + Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199350377 X:146793964-146793986 CAGGCAAAAGAGCAGGGGCAGGG - Intergenic
1199812577 X:151365333-151365355 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1199862791 X:151816871-151816893 TAGGAGAAAGAGCAGGAGAAAGG - Intergenic
1199974485 X:152884949-152884971 AAGGGGTGGGAGCAGGAGAATGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200751138 Y:6945249-6945271 AAGGGGAAAGGGAAGAAGAATGG - Intronic
1200763494 Y:7061607-7061629 TAGGGGAAGGAGAAGGAGAGGGG - Intronic
1200819323 Y:7566085-7566107 GAAGGGAAAGAGGAGGAGAAGGG + Intergenic
1200834295 Y:7717961-7717983 CAGGGGAAAGAGAAGAAGTCTGG - Intergenic
1201184011 Y:11380298-11380320 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1201230147 Y:11856278-11856300 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1201300273 Y:12498833-12498855 CAGGAGGAGGAGGAGGAGAAGGG - Intergenic
1201453001 Y:14136300-14136322 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1201471155 Y:14336290-14336312 CAGAGGACAAAGGAGGAGAAAGG - Intergenic
1201474306 Y:14364193-14364215 GAGGAGGAAGAGGAGGAGAAGGG + Intergenic
1201755641 Y:17483224-17483246 AATGGGATAAAGCAGGAGAAAGG - Intergenic
1201845911 Y:18422761-18422783 AATGGGATAAAGCAGGAGAAAGG + Intergenic
1201977824 Y:19871551-19871573 CAGGGGACAGAGCAAAAGAAAGG - Intergenic
1202371177 Y:24197080-24197102 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202376150 Y:24239389-24239411 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202494630 Y:25430729-25430751 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1202499607 Y:25473037-25473059 CAATGGAAAGAGCAGGAGAAGGG + Intergenic