ID: 1022095968

View in Genome Browser
Species Human (GRCh38)
Location 7:27142064-27142086
Sequence GACAACATAGGCGGCCCGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022095968_1022095972 -3 Left 1022095968 7:27142064-27142086 CCTTCCGGGCCGCCTATGTTGTC 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1022095972 7:27142084-27142106 GTCTGCAATAGAAAAGTCAGCGG 0: 1
1: 0
2: 2
3: 20
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022095968 Original CRISPR GACAACATAGGCGGCCCGGA AGG (reversed) Exonic