ID: 1022098089

View in Genome Browser
Species Human (GRCh38)
Location 7:27153077-27153099
Sequence CCTGGTCTGCAGGCGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022098077_1022098089 -8 Left 1022098077 7:27153062-27153084 CCTGGGGCCCCCTCGCCTGGTCT No data
Right 1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG No data
1022098074_1022098089 -2 Left 1022098074 7:27153056-27153078 CCGGACCCTGGGGCCCCCTCGCC No data
Right 1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG No data
1022098063_1022098089 24 Left 1022098063 7:27153030-27153052 CCCTCCCCGCGCCACCTACTGCA No data
Right 1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG No data
1022098069_1022098089 13 Left 1022098069 7:27153041-27153063 CCACCTACTGCAGTGCCGGACCC No data
Right 1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG No data
1022098064_1022098089 23 Left 1022098064 7:27153031-27153053 CCTCCCCGCGCCACCTACTGCAG No data
Right 1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG No data
1022098062_1022098089 25 Left 1022098062 7:27153029-27153051 CCCCTCCCCGCGCCACCTACTGC No data
Right 1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG No data
1022098067_1022098089 18 Left 1022098067 7:27153036-27153058 CCGCGCCACCTACTGCAGTGCCG No data
Right 1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG No data
1022098076_1022098089 -7 Left 1022098076 7:27153061-27153083 CCCTGGGGCCCCCTCGCCTGGTC No data
Right 1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG No data
1022098061_1022098089 30 Left 1022098061 7:27153024-27153046 CCTAGCCCCTCCCCGCGCCACCT No data
Right 1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG No data
1022098065_1022098089 20 Left 1022098065 7:27153034-27153056 CCCCGCGCCACCTACTGCAGTGC No data
Right 1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG No data
1022098070_1022098089 10 Left 1022098070 7:27153044-27153066 CCTACTGCAGTGCCGGACCCTGG No data
Right 1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG No data
1022098066_1022098089 19 Left 1022098066 7:27153035-27153057 CCCGCGCCACCTACTGCAGTGCC No data
Right 1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022098089 Original CRISPR CCTGGTCTGCAGGCGGGGTG GGG Intergenic
No off target data available for this crispr