ID: 1022098746

View in Genome Browser
Species Human (GRCh38)
Location 7:27156886-27156908
Sequence TGGGGTCTGCGGACGCCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022098732_1022098746 23 Left 1022098732 7:27156840-27156862 CCTGGAGGCTCCGCGGGAGCGCC 0: 1
1: 0
2: 1
3: 19
4: 186
Right 1022098746 7:27156886-27156908 TGGGGTCTGCGGACGCCAGGCGG No data
1022098737_1022098746 1 Left 1022098737 7:27156862-27156884 CCAGCTGGCGGCCAACCTCCGCA 0: 1
1: 0
2: 0
3: 14
4: 115
Right 1022098746 7:27156886-27156908 TGGGGTCTGCGGACGCCAGGCGG No data
1022098741_1022098746 -10 Left 1022098741 7:27156873-27156895 CCAACCTCCGCACTGGGGTCTGC 0: 1
1: 0
2: 0
3: 20
4: 131
Right 1022098746 7:27156886-27156908 TGGGGTCTGCGGACGCCAGGCGG No data
1022098734_1022098746 13 Left 1022098734 7:27156850-27156872 CCGCGGGAGCGCCCAGCTGGCGG 0: 1
1: 0
2: 1
3: 13
4: 139
Right 1022098746 7:27156886-27156908 TGGGGTCTGCGGACGCCAGGCGG No data
1022098736_1022098746 2 Left 1022098736 7:27156861-27156883 CCCAGCTGGCGGCCAACCTCCGC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1022098746 7:27156886-27156908 TGGGGTCTGCGGACGCCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022098746 Original CRISPR TGGGGTCTGCGGACGCCAGG CGG Intronic
No off target data available for this crispr