ID: 1022099935

View in Genome Browser
Species Human (GRCh38)
Location 7:27163464-27163486
Sequence ACAAAGCGGCTCTAAACCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022099935_1022099945 2 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099945 7:27163489-27163511 GGGGATGGTGGAGGCTAGGGTGG 0: 1
1: 0
2: 2
3: 90
4: 925
1022099935_1022099954 30 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099954 7:27163517-27163539 AGAGAAGGGAGAAGGCGGAAGGG 0: 1
1: 2
2: 12
3: 193
4: 1512
1022099935_1022099949 15 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099949 7:27163502-27163524 GCTAGGGTGGGGGTGAGAGAAGG 0: 1
1: 0
2: 12
3: 95
4: 794
1022099935_1022099948 5 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099948 7:27163492-27163514 GATGGTGGAGGCTAGGGTGGGGG 0: 1
1: 0
2: 5
3: 81
4: 1109
1022099935_1022099942 -7 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099942 7:27163480-27163502 GCTTTGTGCGGGGATGGTGGAGG 0: 1
1: 0
2: 1
3: 22
4: 327
1022099935_1022099946 3 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099946 7:27163490-27163512 GGGATGGTGGAGGCTAGGGTGGG 0: 1
1: 0
2: 5
3: 60
4: 658
1022099935_1022099940 -10 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099940 7:27163477-27163499 GCCGCTTTGTGCGGGGATGGTGG 0: 1
1: 0
2: 1
3: 8
4: 103
1022099935_1022099953 29 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG 0: 1
1: 2
2: 20
3: 240
4: 1875
1022099935_1022099943 -2 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099943 7:27163485-27163507 GTGCGGGGATGGTGGAGGCTAGG 0: 1
1: 0
2: 0
3: 48
4: 399
1022099935_1022099944 -1 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099944 7:27163486-27163508 TGCGGGGATGGTGGAGGCTAGGG 0: 1
1: 0
2: 3
3: 25
4: 301
1022099935_1022099950 16 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099950 7:27163503-27163525 CTAGGGTGGGGGTGAGAGAAGGG 0: 1
1: 0
2: 6
3: 97
4: 633
1022099935_1022099947 4 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099947 7:27163491-27163513 GGATGGTGGAGGCTAGGGTGGGG 0: 1
1: 0
2: 2
3: 76
4: 784
1022099935_1022099952 25 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099952 7:27163512-27163534 GGGTGAGAGAAGGGAGAAGGCGG 0: 1
1: 0
2: 14
3: 240
4: 2085
1022099935_1022099951 22 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099951 7:27163509-27163531 TGGGGGTGAGAGAAGGGAGAAGG 0: 1
1: 3
2: 23
3: 326
4: 2022

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022099935 Original CRISPR ACAAAGCGGCTCTAAACCTC AGG (reversed) Exonic
902890753 1:19441700-19441722 ACCAAGCGGCTCAAAAGCTCAGG + Intronic
914992411 1:152510487-152510509 CCAATACGGCTCTACACCTCTGG - Intergenic
919798406 1:201335893-201335915 ACCAAGCGGTTCTAAATCTCTGG + Intergenic
1065243208 10:23729240-23729262 ATAAAGCTGCTATAAACATCTGG + Intronic
1067071367 10:43135046-43135068 ACAAAGAGGCTCAAAACATAGGG - Intergenic
1067686284 10:48467763-48467785 ACAAAGCTGGTCTTAAACTCAGG - Intronic
1071833601 10:89396454-89396476 ACAAAGAGGGTCTAAACCCAGGG + Intronic
1077527258 11:3074695-3074717 AAAAAGTGGCTTAAAACCTCAGG - Intergenic
1108146368 13:47481553-47481575 GCAAAGCAGCTCAAAAGCTCTGG + Intergenic
1109256540 13:60090088-60090110 ACAAAGTGGCTCTCCAACTCTGG + Intronic
1121655203 14:95590066-95590088 ACAAAACTGATCTAAACCTGGGG + Intergenic
1136651517 16:31677263-31677285 AGAAAGAAGCACTAAACCTCAGG - Intergenic
1139191062 16:64863948-64863970 ACTGAGCAGCTCTAAACATCAGG + Intergenic
1165855383 19:38876804-38876826 TCAAAGCTGCTCTAGCCCTCGGG + Intronic
927323153 2:21771676-21771698 ACAAAGCTGCTAAAAGCCTCAGG - Intergenic
932245262 2:70191171-70191193 ACCTAGCGGCTGTAAAGCTCAGG + Intronic
936915780 2:117637837-117637859 GCAAAGCGGCTCTAGACCATGGG + Intergenic
940086702 2:149867368-149867390 ACAAAAGGAATCTAAACCTCAGG + Intergenic
941504368 2:166323289-166323311 ACACAGAGTCTCTAAAACTCTGG - Intronic
943584655 2:189723859-189723881 CCAAAGTAGCTCTAAAGCTCAGG - Intronic
1168984283 20:2034745-2034767 GGAAAGGGGCTCTAAACCACAGG - Intergenic
1181003363 22:19998315-19998337 ACAAAGAGGCTCTGTCCCTCAGG - Intronic
1185107794 22:48884198-48884220 AGTAAGCGGCTCTAGAGCTCTGG - Intergenic
950478765 3:13231783-13231805 ACAACGGGTCTCTAAACCTCAGG + Intergenic
950642715 3:14358864-14358886 GCAAAGTGGGTCTAACCCTCAGG - Intergenic
953938582 3:47069453-47069475 ACAAAGTGAATCTAAATCTCTGG + Intronic
960388184 3:117046145-117046167 ACAAAGCTGGTCTTAAACTCAGG - Intronic
969036911 4:4261791-4261813 ACTTAGCATCTCTAAACCTCAGG - Intergenic
980219270 4:129894698-129894720 ACAGAGCTGCTCTCAAACTCAGG - Intergenic
985213215 4:187617905-187617927 ACAAAGCAGCTCCAGAACTCAGG - Intergenic
988874833 5:35432377-35432399 ACAACGCTGCTCTAAACCCACGG + Intergenic
995396218 5:111689786-111689808 ACAAATCTGTTCTAAACATCAGG - Intronic
997224995 5:132203227-132203249 AGAAAGCGGCACTAAACCCCTGG - Intronic
1001968630 5:175935465-175935487 ACAAAGCTGCTCTGAACATTTGG - Intronic
1003068285 6:2921386-2921408 ACAATGCGACGCCAAACCTCTGG - Intergenic
1008199211 6:48565143-48565165 GCAAAGCGGCTCAAGACCTTGGG + Intergenic
1018597404 6:165496813-165496835 ACAAAGAGATTTTAAACCTCTGG - Intronic
1022099935 7:27163464-27163486 ACAAAGCGGCTCTAAACCTCAGG - Exonic
1036619239 8:10413018-10413040 ACAAAGCTGCTGTAAACATTTGG - Intronic
1038839734 8:31172338-31172360 CCAAAGAGCCTCTAACCCTCAGG - Intronic
1048524488 8:135189483-135189505 ACACAGAGGCTCTAGACATCTGG - Intergenic
1051767373 9:20539997-20540019 ACAAAGAGGCTACAAACCCCAGG + Intronic
1056625825 9:88252319-88252341 ACAGAGCTGCCCAAAACCTCAGG + Intergenic
1060701411 9:125752600-125752622 CCAAAGAGTCTCTAAACCTGTGG - Intronic
1061938703 9:133872600-133872622 ACAAAGCGACTCTGACCCCCGGG - Intronic
1189295980 X:39918178-39918200 ACAAAGAACCTCTACACCTCTGG + Intergenic
1196338004 X:114561809-114561831 ACAAGGCTGCTATAAACCTGAGG - Intergenic