ID: 1022099941

View in Genome Browser
Species Human (GRCh38)
Location 7:27163478-27163500
Sequence TCCACCATCCCCGCACAAAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 94}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022099941_1022099954 16 Left 1022099941 7:27163478-27163500 CCGCTTTGTGCGGGGATGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1022099954 7:27163517-27163539 AGAGAAGGGAGAAGGCGGAAGGG 0: 1
1: 2
2: 12
3: 193
4: 1512
1022099941_1022099948 -9 Left 1022099941 7:27163478-27163500 CCGCTTTGTGCGGGGATGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1022099948 7:27163492-27163514 GATGGTGGAGGCTAGGGTGGGGG 0: 1
1: 0
2: 5
3: 81
4: 1109
1022099941_1022099956 18 Left 1022099941 7:27163478-27163500 CCGCTTTGTGCGGGGATGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1022099956 7:27163519-27163541 AGAAGGGAGAAGGCGGAAGGGGG 0: 1
1: 2
2: 54
3: 309
4: 1830
1022099941_1022099949 1 Left 1022099941 7:27163478-27163500 CCGCTTTGTGCGGGGATGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1022099949 7:27163502-27163524 GCTAGGGTGGGGGTGAGAGAAGG 0: 1
1: 0
2: 12
3: 95
4: 794
1022099941_1022099950 2 Left 1022099941 7:27163478-27163500 CCGCTTTGTGCGGGGATGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1022099950 7:27163503-27163525 CTAGGGTGGGGGTGAGAGAAGGG 0: 1
1: 0
2: 6
3: 97
4: 633
1022099941_1022099947 -10 Left 1022099941 7:27163478-27163500 CCGCTTTGTGCGGGGATGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1022099947 7:27163491-27163513 GGATGGTGGAGGCTAGGGTGGGG 0: 1
1: 0
2: 2
3: 76
4: 784
1022099941_1022099952 11 Left 1022099941 7:27163478-27163500 CCGCTTTGTGCGGGGATGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1022099952 7:27163512-27163534 GGGTGAGAGAAGGGAGAAGGCGG 0: 1
1: 0
2: 14
3: 240
4: 2085
1022099941_1022099957 22 Left 1022099941 7:27163478-27163500 CCGCTTTGTGCGGGGATGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1022099957 7:27163523-27163545 GGGAGAAGGCGGAAGGGGGACGG 0: 1
1: 6
2: 54
3: 434
4: 3006
1022099941_1022099955 17 Left 1022099941 7:27163478-27163500 CCGCTTTGTGCGGGGATGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1022099955 7:27163518-27163540 GAGAAGGGAGAAGGCGGAAGGGG 0: 1
1: 1
2: 22
3: 241
4: 1836
1022099941_1022099951 8 Left 1022099941 7:27163478-27163500 CCGCTTTGTGCGGGGATGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1022099951 7:27163509-27163531 TGGGGGTGAGAGAAGGGAGAAGG 0: 1
1: 3
2: 23
3: 326
4: 2022
1022099941_1022099953 15 Left 1022099941 7:27163478-27163500 CCGCTTTGTGCGGGGATGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG 0: 1
1: 2
2: 20
3: 240
4: 1875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022099941 Original CRISPR TCCACCATCCCCGCACAAAG CGG (reversed) Exonic
902984078 1:20144743-20144765 TCCACCATCCCAGCACAGGCTGG - Intronic
908021179 1:59900666-59900688 TCCACCACCAGCTCACAAAGAGG - Intronic
914743639 1:150485482-150485504 TCCCCCATCACCTCAGAAAGAGG - Intergenic
922155836 1:223039155-223039177 TCCACCATCCCATCAGACAGGGG + Intergenic
923278157 1:232416217-232416239 ACCACCATCCCCTCCCAAAGTGG + Intronic
923961143 1:239085021-239085043 CCCACCATGCCCCCACCAAGAGG + Intergenic
1066577218 10:36839352-36839374 ACCAGCATCCCCTCACTAAGAGG - Intergenic
1069409751 10:68141067-68141089 TCCACCACCCCCCCAAAAAAAGG + Intronic
1069640963 10:69955346-69955368 TCCACCATCCACGCACCAATGGG + Intronic
1070681196 10:78450413-78450435 TCAACCACTCCTGCACAAAGTGG + Intergenic
1071097390 10:81993591-81993613 CCCACCATGTCCTCACAAAGAGG + Intronic
1071480943 10:86064549-86064571 TCCTCCATCCCAGAACACAGAGG + Intronic
1076697881 10:132255882-132255904 TCCACCGTCCCCTCACCCAGGGG + Intronic
1077083891 11:737984-738006 TCCACCCTCCCTGCACATAGAGG + Intergenic
1077269739 11:1670194-1670216 TCCACAGTTCCCCCACAAAGGGG + Intergenic
1077880578 11:6346495-6346517 TCCCCCAACCCCGCCCACAGTGG + Intergenic
1083714375 11:64567365-64567387 TCCACCATCCCTTCACACACAGG - Intronic
1084791613 11:71478526-71478548 TCCACCAGGCCCGCACGAATGGG - Intronic
1088378393 11:109167063-109167085 ACCACCATCCCATCACCAAGAGG - Intergenic
1089508282 11:118979492-118979514 TCTCCCATCCCCTCACAAAAGGG + Exonic
1096771216 12:53937194-53937216 ACCACCTTCTCCCCACAAAGAGG + Intergenic
1101348775 12:103908691-103908713 TCCCCCTTCCCCGCAAAAAAAGG + Intergenic
1102575746 12:113855142-113855164 TCCACCGTCCCCGAACTGAGGGG - Intronic
1106120390 13:26855260-26855282 TCCACCCTCCCCTGACACAGAGG + Intergenic
1110393227 13:75000210-75000232 TCCTCCATCCCCGAGCAGAGTGG - Intergenic
1110906914 13:80901379-80901401 TCCACCATGGCTGCACTAAGAGG - Intergenic
1113458748 13:110467215-110467237 TCCAGCATCTCAGCACAAACTGG + Intronic
1113675085 13:112201758-112201780 TCCACCATCACCGCACCGAGGGG + Intergenic
1113897465 13:113775434-113775456 TCCACCAGCCCCACCCAAAGGGG - Intronic
1115664456 14:35533330-35533352 TCCACTGTCCTCGCATAAAGTGG - Intergenic
1116952156 14:50888589-50888611 TCCACCCTCCCCTCCCCAAGAGG - Intronic
1126537061 15:49777988-49778010 ACCAACATCTCCCCACAAAGTGG + Intergenic
1129585270 15:76856572-76856594 TCCCCCATCCCCACACACAAAGG - Intronic
1131016341 15:89060513-89060535 TGCCCCATCCCAGCACAAACAGG + Intergenic
1131626646 15:94127603-94127625 TCCACCATCCCCTCACTACCGGG - Intergenic
1132239748 15:100248626-100248648 GCCACCATCCCCTCACTGAGTGG - Intronic
1137484137 16:48877555-48877577 CCCACCCTCCCTGCACAGAGAGG - Intergenic
1138460162 16:57143297-57143319 GCCACCATGCCCACACACAGGGG - Intronic
1139840435 16:69874162-69874184 ACCACCATCACAGCAGAAAGGGG - Intronic
1151474479 17:74337974-74337996 GCCACGATCCCCGCTTAAAGAGG - Intronic
1152772302 17:82177709-82177731 TCCCACCTCCCCGCACTAAGCGG - Intronic
1155323732 18:24645189-24645211 TCCCCCATCCCCCCAAAAAAAGG - Intergenic
1164926873 19:32137612-32137634 TCCACCATAACCCCAGAAAGTGG + Intergenic
1165485402 19:36092531-36092553 TCCAGCACCCCTGCACTAAGCGG + Intronic
1166227573 19:41406139-41406161 TCCACCAGCCCAGCAAAGAGGGG + Intronic
1166366423 19:42280676-42280698 TCCGCCCTCCCTGCACAAAGCGG + Intronic
927194632 2:20539003-20539025 TGCACCTTCCCAGCACAAAGGGG + Intergenic
929419626 2:41777578-41777600 TCTCCCACCCCCGCACACAGAGG + Intergenic
930110224 2:47672591-47672613 GCCACCATGCCCGAACGAAGGGG - Intergenic
930790331 2:55320188-55320210 TATACCATCTCAGCACAAAGAGG + Intronic
937471940 2:122181509-122181531 CCCACCATCCCACCACACAGAGG - Intergenic
941463985 2:165803325-165803347 TCCCACATCCCAGCTCAAAGTGG - Intergenic
942193228 2:173492263-173492285 TTCTCCATCACAGCACAAAGAGG - Intergenic
944766051 2:202865180-202865202 GCCACCATGCCCGGCCAAAGAGG - Intronic
945036604 2:205708784-205708806 TCCACAATCCCCTCACAACCAGG - Intronic
947662791 2:231882447-231882469 ACCCCCATCCCATCACAAAGGGG + Intergenic
947710390 2:232310471-232310493 TCCACCGTCCACCCACACAGAGG + Intronic
1179722540 21:43323828-43323850 GCCACCCTCCCAGCACAAGGTGG - Intergenic
1182144239 22:27987376-27987398 TCCACCACCCCCACACCAAAGGG + Intronic
1184205947 22:43003171-43003193 TTTACCTTCCACGCACAAAGTGG - Intronic
951463121 3:22972138-22972160 TCCACCATCCTAGCATATAGAGG - Intergenic
954384503 3:50237156-50237178 TCCACCCTTCCTGCACCAAGTGG + Intronic
963115729 3:141727548-141727570 TCCACCATCACCTCAGCAAGTGG + Intergenic
964479579 3:157128221-157128243 TCCACCACCCCCGGGCCAAGAGG + Intergenic
966243808 3:177783644-177783666 AACACCATCCCCACTCAAAGTGG + Intergenic
971174883 4:24272644-24272666 TCCAAGATCCTCACACAAAGTGG + Intergenic
975074659 4:70190717-70190739 TCCACCAGCCCCTCACTAATTGG + Intergenic
975739662 4:77417286-77417308 TCCAACATCCCTTCACAATGAGG - Intronic
979529980 4:121759916-121759938 TACACCAACCCTCCACAAAGAGG + Exonic
981011978 4:139934541-139934563 TCCATCACCCCCTCAGAAAGAGG + Intronic
986302685 5:6490600-6490622 TCCACCGTCACCTCACAAAATGG + Intronic
992354251 5:75964454-75964476 TCCCCTATCCCTGCACACAGAGG - Intergenic
993089030 5:83400790-83400812 TCCAGCATCCCTACACAATGGGG + Intergenic
999021514 5:148171089-148171111 TCCACCACCCTCGTACAAATAGG - Intronic
1002711669 5:181198642-181198664 TCCACCACCACCGCACTATGTGG + Intronic
1002718545 5:181244236-181244258 TCAACCCTCCCCGCACCAAGTGG - Intronic
1006039544 6:31242793-31242815 TCCACCATTCCCTCATCAAGAGG + Intergenic
1007473991 6:42107176-42107198 TCCAGCATCTCCTCACACAGTGG - Exonic
1012121623 6:95374646-95374668 TCCACCCTCCACCCTCAAAGAGG - Intergenic
1017443064 6:154482383-154482405 TCCACCATCCAGTCCCAAAGTGG + Intronic
1018255162 6:161911288-161911310 TCCACCAGCCTGTCACAAAGGGG - Intronic
1022099941 7:27163478-27163500 TCCACCATCCCCGCACAAAGCGG - Exonic
1025762173 7:64405141-64405163 TGCACCATCCTTGCACAAGGTGG + Intergenic
1027392687 7:77721084-77721106 ACCACCACCCAAGCACAAAGCGG - Intronic
1027434081 7:78145750-78145772 TCCACTATAACAGCACAAAGTGG + Intronic
1033624674 7:143097212-143097234 TCCCCCCACCCCCCACAAAGTGG + Intergenic
1034458851 7:151187045-151187067 TCCACCAGCCTGGCACAGAGGGG + Exonic
1039367373 8:36944453-36944475 TCCACCCTCCCCACTCAAACAGG - Intergenic
1039439420 8:37584404-37584426 TTGACCATCCCCTCACCAAGAGG - Intergenic
1043232809 8:77823825-77823847 TCTAACATCCCTGGACAAAGTGG - Intergenic
1044177948 8:89153128-89153150 TTCTCCATCCCCTAACAAAGTGG - Intergenic
1044390285 8:91641900-91641922 CCCACCAACCCCCTACAAAGTGG + Intergenic
1049034277 8:140062206-140062228 TCCACCTTCCCTGTACACAGCGG + Intronic
1049726551 8:144148966-144148988 ACCACCATCCCCTTCCAAAGTGG - Intronic
1050387947 9:5110822-5110844 CCCACCTTCCCCGAACAAACGGG - Intronic
1050574197 9:6975793-6975815 TCCACCCACCTCGCCCAAAGCGG - Intronic
1050701728 9:8347273-8347295 CCCACCATCCAGGGACAAAGAGG + Intronic
1055503559 9:76925842-76925864 TCCCCCCTCCCCGCAAAAAAAGG + Intergenic
1059257710 9:112945946-112945968 TCCACGATCCCCGCACCCAGTGG + Intergenic
1060766394 9:126297477-126297499 TCCTCCCTCCTCGCACAAGGGGG - Intergenic
1061172407 9:128967406-128967428 CCCACCTTCACCTCACAAAGTGG - Intronic
1199622136 X:149711647-149711669 TCCACCCTCCCCACATAGAGGGG + Intronic
1199626957 X:149750244-149750266 TCCACCCTCCCCACATAGAGGGG + Intergenic
1199629042 X:149763226-149763248 TCCACCGTCCCCACATAGAGGGG - Intergenic
1199897709 X:152139023-152139045 TCCACCCACCCCTCACAAAGGGG - Intergenic
1200071758 X:153532610-153532632 TGCACCATCCCCGCACAGACTGG - Intronic