ID: 1022099953

View in Genome Browser
Species Human (GRCh38)
Location 7:27163516-27163538
Sequence GAGAGAAGGGAGAAGGCGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2138
Summary {0: 1, 1: 2, 2: 20, 3: 240, 4: 1875}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022099935_1022099953 29 Left 1022099935 7:27163464-27163486 CCTGAGGTTTAGAGCCGCTTTGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG 0: 1
1: 2
2: 20
3: 240
4: 1875
1022099941_1022099953 15 Left 1022099941 7:27163478-27163500 CCGCTTTGTGCGGGGATGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG 0: 1
1: 2
2: 20
3: 240
4: 1875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022099953 Original CRISPR GAGAGAAGGGAGAAGGCGGA AGG Exonic
Too many off-targets to display for this crispr