ID: 1022100210

View in Genome Browser
Species Human (GRCh38)
Location 7:27164927-27164949
Sequence TTCAGAGAAGGCGCCTTCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022100207_1022100210 3 Left 1022100207 7:27164901-27164923 CCGCCGCTCTCATTCTCAGCATT 0: 1
1: 0
2: 1
3: 15
4: 243
Right 1022100210 7:27164927-27164949 TTCAGAGAAGGCGCCTTCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 67
1022100208_1022100210 0 Left 1022100208 7:27164904-27164926 CCGCTCTCATTCTCAGCATTGTT 0: 1
1: 0
2: 0
3: 40
4: 372
Right 1022100210 7:27164927-27164949 TTCAGAGAAGGCGCCTTCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022100210 Original CRISPR TTCAGAGAAGGCGCCTTCGC TGG Exonic
900399966 1:2468972-2468994 TTCAGAGAGGGCACCTCCACTGG - Intronic
900913519 1:5618768-5618790 TGCACAGAAGGTGCCTTCTCAGG - Intergenic
900986915 1:6078509-6078531 TCCAGAGAAAGAGCCTTCGGGGG + Intronic
902139140 1:14337597-14337619 TTAAGAGAAGCCTCCTTGGCTGG + Intergenic
902735419 1:18397617-18397639 TTCAGAGAAGGAAGCTTCCCTGG - Intergenic
908251493 1:62269372-62269394 TTCAGAGAAGGGTCCTTAGGGGG - Intronic
919463754 1:197908749-197908771 TTCTGAGAAAGCCCCTTAGCAGG + Intergenic
921314627 1:213878635-213878657 TTCAGAGAAGGCTCCGTCCCTGG - Intergenic
1063494425 10:6493900-6493922 TTCAGAGAAGGCGAAGTGGCTGG - Intronic
1067756269 10:49008215-49008237 TACAGAGAAGGAGCCTCTGCAGG + Intergenic
1069027749 10:63562210-63562232 TTCAGTGAAGTCGCTTTCACAGG + Intronic
1070462515 10:76684075-76684097 TTCAGAGAAGGTGCCTTCTGGGG - Intergenic
1076642365 10:131927388-131927410 TTCAGAGAGGGCGGGTGCGCGGG + Intronic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1083953552 11:65970382-65970404 GTCAGAAAAGGCTCCTTTGCGGG - Intronic
1084697256 11:70763051-70763073 TTCAGATCAGGCTCCTTGGCAGG - Intronic
1091305725 11:134535040-134535062 TTCAGAGCTGGCCCTTTCGCAGG + Intergenic
1117054563 14:51898603-51898625 TTCAGACAAAGAGCCTTCCCTGG - Intronic
1122029476 14:98901924-98901946 TGCAGAGGAGGCGCCTTCCTGGG - Intergenic
1122664192 14:103317360-103317382 TCCTGAGAAGACGCCTTCTCCGG + Intergenic
1123496640 15:20833596-20833618 ATCAGAGAAGGCACCTTCACTGG - Intergenic
1123553875 15:21407188-21407210 ATCAGAGAAGGCACCTTCACTGG - Intergenic
1123590119 15:21844553-21844575 ATCAGAGAAGGCACCTTCACTGG - Intergenic
1202962221 15_KI270727v1_random:134384-134406 ATCAGAGAAGGCACCTTCACTGG - Intergenic
1132655012 16:1038153-1038175 TTCACATATGGCGCCTTCCCAGG + Intergenic
1137579253 16:49623270-49623292 CTGAGGGAAGGCGCCTTGGCTGG - Intronic
1140265904 16:73420443-73420465 TGCAGGGAAGGCGGCGTCGCTGG + Intergenic
1153051514 18:906399-906421 CTCGGAGAAGGCAGCTTCGCAGG - Intronic
1154454550 18:14509280-14509302 ATCAGAGAAGGCACCTTCACTGG - Intronic
1155071093 18:22316977-22316999 TTCAGAGAAGGCCACATGGCTGG + Intergenic
1162154922 19:8671186-8671208 CTCAGAGATGGCCCCATCGCAGG - Intergenic
1164853575 19:31503675-31503697 TTCAGAGAATGAGCATTTGCAGG + Intergenic
925037207 2:697375-697397 TTGACAGAAGGCTCCTTGGCAGG - Intergenic
926198540 2:10777771-10777793 TTCCCAGAAGGCGCCTGAGCTGG - Intronic
929813655 2:45213381-45213403 TTAAGACAAGCCCCCTTCGCTGG - Intergenic
932241698 2:70162345-70162367 TTAAGAGTAGGGGCCTTTGCTGG + Intronic
932808641 2:74805450-74805472 TTCAGAGAAGAGGGCTTCTCTGG - Intergenic
937038922 2:118806189-118806211 TGCAGAGAAGGTACCTTTGCAGG - Intergenic
1169181979 20:3577387-3577409 CTCAGAGAAGGCCCATTAGCAGG - Intronic
1172023783 20:31934439-31934461 CTCAGAAAAGGGGCCTACGCAGG + Intronic
1176368790 21:6050055-6050077 TTCAGAGCAGGCGCATCCACAGG - Intergenic
1176819618 21:13644028-13644050 ATCAAAGAAGGCACCTTCACTGG + Intergenic
1177783341 21:25642948-25642970 TTCATAGATGGAGCCTTCTCAGG + Intronic
1178952884 21:36999599-36999621 TCCAGAGAAGGCGTCATCCCCGG + Intergenic
1179113290 21:38465926-38465948 TTCAGAGGAGGTGCCTGGGCTGG + Intronic
1179249753 21:39663055-39663077 TTCAGAAAAGCCTCCTTCTCAGG + Exonic
1179550500 21:42140712-42140734 TACAGGGAAGGAGCCTTCCCAGG + Intronic
1179754729 21:43488487-43488509 TTCAGAGCAGGCGCATCCACAGG + Intergenic
1180832724 22:18914059-18914081 TTCAGAGCAGCCGCCTTCCGAGG - Intronic
1180859508 22:19069258-19069280 TTCAGGGAAGGAGGCTTTGCAGG - Intronic
1181067140 22:20312335-20312357 TTCAGAGCAGCCGCCTTCCGAGG + Intergenic
1182538500 22:31024154-31024176 TTAAGAGATGGGGCCTTAGCTGG - Intergenic
1203282809 22_KI270734v1_random:139364-139386 TTCAGAGCAGCCGCCTTCCGAGG - Intergenic
955749246 3:62170577-62170599 TTCAGAGAAGGCCCGTTCAGTGG - Intronic
962378972 3:134881431-134881453 TTGAGCGAAGGTGCCTTAGCTGG + Intronic
964118594 3:153160863-153160885 TTCAGAGGAAGCGTCTTCGCTGG - Intergenic
968844555 4:3033084-3033106 TTCAAAGATGGAGCCTTGGCTGG + Intronic
969511040 4:7618150-7618172 TTCACAGAAGCCTCCTCCGCAGG + Intronic
985492606 5:188200-188222 TTCAGAGAAGGCTCCATCCTGGG + Exonic
985515673 5:343620-343642 TCCAGAGCAGGCGGCTTCTCTGG + Intronic
986114619 5:4759972-4759994 TTCATAGAATGCTCCTTCTCAGG - Intergenic
987077607 5:14398520-14398542 TTCAGAGGAGGAGCTTTCGGTGG + Intronic
998385119 5:141753157-141753179 GTCAGAGAAGGAGCCTTGGAGGG + Intergenic
999941099 5:156544002-156544024 TTCAGAGAATGCCTCTTCACTGG - Intronic
1003489736 6:6610923-6610945 TTCAAAGAAGGAGCCTTCCTTGG - Intronic
1019316769 7:390555-390577 CTCTGAGAAGGCGCCTCTGCCGG + Intergenic
1022100210 7:27164927-27164949 TTCAGAGAAGGCGCCTTCGCTGG + Exonic
1034337180 7:150331094-150331116 TTCAGAGAAGGCTCCTGTGGGGG - Exonic
1038333523 8:26628437-26628459 TTCAGAGCAGGGGCCTGTGCTGG + Intronic
1044567098 8:93676625-93676647 TTCAGAGATGGGGTCTTGGCAGG + Intergenic
1049599420 8:143500108-143500130 CTCAGAGAAGGCCCCTTTGAGGG - Intronic
1049798524 8:144507240-144507262 TTCAGAGAAGGGACCTTCCACGG + Intergenic
1050448445 9:5752894-5752916 TTCAGAGAAGGCACCTGTGAGGG - Intronic
1203527742 Un_GL000213v1:105542-105564 ATCAAAGAAGGCACCTTCACTGG - Intergenic
1187479202 X:19639586-19639608 TTCAGAGTGGGAGCCTTCCCAGG - Intronic
1201481430 Y:14443624-14443646 ATCAGAGAAGGAGCCTTTGAGGG + Intergenic