ID: 1022101018

View in Genome Browser
Species Human (GRCh38)
Location 7:27169256-27169278
Sequence CTGCTCCTTCGCGGACGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022101018_1022101028 12 Left 1022101018 7:27169256-27169278 CCCCGGCGTCCGCGAAGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1022101028 7:27169291-27169313 TACCTGCTGTGACCAGGTGGAGG 0: 1
1: 0
2: 1
3: 17
4: 169
1022101018_1022101031 22 Left 1022101018 7:27169256-27169278 CCCCGGCGTCCGCGAAGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1022101031 7:27169301-27169323 GACCAGGTGGAGGTGTGTGGTGG 0: 1
1: 0
2: 3
3: 50
4: 471
1022101018_1022101034 27 Left 1022101018 7:27169256-27169278 CCCCGGCGTCCGCGAAGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1022101034 7:27169306-27169328 GGTGGAGGTGTGTGGTGGAAGGG 0: 1
1: 0
2: 5
3: 77
4: 709
1022101018_1022101024 6 Left 1022101018 7:27169256-27169278 CCCCGGCGTCCGCGAAGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1022101024 7:27169285-27169307 TAACCCTACCTGCTGTGACCAGG 0: 1
1: 0
2: 1
3: 2
4: 107
1022101018_1022101035 28 Left 1022101018 7:27169256-27169278 CCCCGGCGTCCGCGAAGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1022101035 7:27169307-27169329 GTGGAGGTGTGTGGTGGAAGGGG 0: 1
1: 0
2: 13
3: 113
4: 1096
1022101018_1022101030 19 Left 1022101018 7:27169256-27169278 CCCCGGCGTCCGCGAAGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1022101030 7:27169298-27169320 TGTGACCAGGTGGAGGTGTGTGG 0: 1
1: 0
2: 2
3: 64
4: 542
1022101018_1022101026 9 Left 1022101018 7:27169256-27169278 CCCCGGCGTCCGCGAAGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1022101026 7:27169288-27169310 CCCTACCTGCTGTGACCAGGTGG 0: 1
1: 0
2: 1
3: 23
4: 150
1022101018_1022101033 26 Left 1022101018 7:27169256-27169278 CCCCGGCGTCCGCGAAGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1022101033 7:27169305-27169327 AGGTGGAGGTGTGTGGTGGAAGG 0: 1
1: 0
2: 6
3: 86
4: 923

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022101018 Original CRISPR CTGCTCCTTCGCGGACGCCG GGG (reversed) Intronic
900418817 1:2546865-2546887 CTGCTCCTGGGCAGAGGCCGAGG - Intergenic
900693495 1:3995772-3995794 CTGCTCCTTCCAGGGAGCCGAGG + Intergenic
901883367 1:12206869-12206891 CTCGTCCTTCGGGGACTCCGAGG - Exonic
902520340 1:17012023-17012045 CTGCTCCTCCGCACACACCGGGG + Intergenic
903013666 1:20348228-20348250 CAGCTCCTTCGCGGAAGACAAGG - Exonic
904005441 1:27360945-27360967 CGCCTCCTCCGCGGGCGCCGTGG + Exonic
904809877 1:33156528-33156550 CTGCTCCTTCTCGGTCTCCTTGG + Intronic
918015859 1:180632066-180632088 CTCCTCCTCCGCCGCCGCCGAGG - Exonic
1073577459 10:104638792-104638814 CTGCTCCTGCTCAGAGGCCGCGG + Intergenic
1074065174 10:110007572-110007594 CTGGCCCTCCGGGGACGCCGCGG + Intronic
1077301618 11:1849865-1849887 CTACTCCTCCGCAGACGCCAGGG - Intergenic
1077916068 11:6612156-6612178 CGGCTCCGGCGCGGACCCCGAGG - Exonic
1083361619 11:62112625-62112647 CTGCGCCTGCGCGGACGACTGGG + Intergenic
1083670871 11:64299425-64299447 CTGCTCCTTCTCCGGCGGCGGGG - Exonic
1088653230 11:111976736-111976758 CTGCTCCTCCGGAGACGCCCTGG + Intronic
1103566314 12:121817577-121817599 CTCCTCCTTGTCGGAGGCCGAGG - Exonic
1113806152 13:113110802-113110824 GTGCTCCTTCGAGGAGGCCCGGG + Exonic
1124233631 15:27968044-27968066 CTGCTCTTTCGCTGACGTCCTGG + Intronic
1124957225 15:34367314-34367336 CTGCTCCTCCGCGCCCGCCGCGG + Intergenic
1125723317 15:41855515-41855537 CTGCTCCTTCGCGGATGGTGTGG + Intronic
1128279948 15:66386714-66386736 GGGGTCCGTCGCGGACGCCGTGG - Intronic
1128809494 15:70560443-70560465 CTTCTCCTTCACGGAAGCCTCGG + Intergenic
1135836826 16:25833686-25833708 CTGCTTCTTCTCTGATGCCGTGG + Intronic
1140934755 16:79660116-79660138 CTGCTCCTTCTTGGACCCTGGGG + Intergenic
1142393176 16:89816149-89816171 CGGCCCCACCGCGGACGCCGGGG + Intronic
1145012461 17:19377752-19377774 CTGCTCCTCTGCGGAGCCCGCGG - Exonic
1148018736 17:44539945-44539967 CTGCCCCTTCCCCCACGCCGAGG - Intergenic
1151930226 17:77227576-77227598 CTGCCCCATCGGGGACGCAGAGG - Intergenic
1154278195 18:12979884-12979906 CACCTCCTTCGCGGACGGGGCGG + Intronic
1160100684 18:75916847-75916869 CTGCACCTGCGCGGAGGCCCAGG + Intergenic
1160834844 19:1119778-1119800 CTGCTCCTCCTCGGACACTGGGG - Intronic
1163558951 19:18007930-18007952 CTGGTCTCTCGCGGACCCCGGGG - Intronic
1163598305 19:18233161-18233183 CTGCCCCTTCGCCGACCCCCAGG + Exonic
1164727757 19:30478053-30478075 GAGCTCCTTCAAGGACGCCGAGG - Intronic
925915142 2:8599744-8599766 CTGCCCCCTCGGGGACGCTGGGG + Intergenic
929604244 2:43224819-43224841 CTGCGCCTCCGCGGCGGCCGCGG - Exonic
932180908 2:69644695-69644717 CTCCTCCTTTGCTGACGCTGTGG + Intronic
932316800 2:70790198-70790220 CTGCTCGTTGGCGGCCGCTGCGG - Intronic
934756220 2:96826714-96826736 CTGCTCCATCGAGGACCCCCTGG + Intronic
936104947 2:109615232-109615254 CTCCTCCTCCGCGGACGACGAGG - Exonic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948578521 2:238969207-238969229 CAGCTCCCTAGCGGACCCCGAGG - Intergenic
1170674521 20:18467006-18467028 CTCCTCCTTCGCCGCCGCCCGGG + Exonic
1175521500 20:59605101-59605123 CACCTCCTCCGCGGACGCCGGGG + Exonic
1175696922 20:61109509-61109531 CAGCTCCTTCCTGGACGCTGTGG + Intergenic
1178314805 21:31559003-31559025 CTGCAGCTCCGCGGACGCCTTGG - Intronic
1181030466 22:20146991-20147013 CTTCTCTCTCACGGACGCCGCGG + Intronic
1183651313 22:39155504-39155526 CTGCTCTTCCGCTGTCGCCGTGG + Intergenic
950436534 3:12983638-12983660 CAGCTCCTTCAGGGACGCCTGGG + Intronic
952886021 3:38011337-38011359 CCGCACCTTCGCCGAGGCCGCGG - Exonic
955763815 3:62319000-62319022 CAGCTACTGCGCCGACGCCGGGG - Intronic
958638517 3:96776801-96776823 CTGCCCCGCCGCGCACGCCGCGG + Intergenic
961451703 3:127005137-127005159 CTGCTCCTTCGAGGACTTCACGG + Exonic
976388070 4:84482861-84482883 CTGCGCCTCCGCTGACCCCGGGG - Intergenic
985555302 5:555193-555215 CGGCTTCCTCGCGGGCGCCGGGG + Intergenic
988553260 5:32215886-32215908 CTGCTCCTTCTCGGCCTCCCTGG - Intergenic
992004149 5:72461274-72461296 CTGCTCCTTCGAAGACCCCGGGG + Exonic
1001948032 5:175796749-175796771 CAGCTCCTCCGCGGCCGACGAGG - Exonic
1004452429 6:15759142-15759164 CTGCCCCTTCCCGCAAGCCGAGG + Intergenic
1010569730 6:77462938-77462960 CTGGGCCATCACGGACGCCGTGG - Exonic
1015541425 6:134317819-134317841 CTGCTCTTCCGCGGCCGGCGCGG + Exonic
1022101018 7:27169256-27169278 CTGCTCCTTCGCGGACGCCGGGG - Intronic
1029712511 7:102307372-102307394 CTGATCCTTTGCGGATGCCCAGG - Intronic
1035019733 7:155793880-155793902 CTGCTCCTTGGTGGAGGCCAAGG + Intergenic
1036621100 8:10424903-10424925 CTGCTCCTTCGCTGTCCCCCGGG - Intronic
1038963712 8:32548881-32548903 CTCCTCCTCCTCGGATGCCGTGG + Intronic
1049083082 8:140457761-140457783 CTGCTCCTGCGCGTGCGCGGAGG + Intronic
1051591176 9:18777670-18777692 CTCCTCCACCGGGGACGCCGGGG + Exonic
1057152455 9:92807969-92807991 CTGCTGCTTCTCCGACGCCAGGG + Intergenic
1057720590 9:97528726-97528748 CTGCTCCTGCTCTGAAGCCGTGG - Intronic
1061540737 9:131276919-131276941 CTGCTTCGCCGCGGCCGCCGAGG + Intergenic