ID: 1022101568

View in Genome Browser
Species Human (GRCh38)
Location 7:27172553-27172575
Sequence GGGGTGCTTACTTGGAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 96}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022101565_1022101568 -8 Left 1022101565 7:27172538-27172560 CCAGGCTAGGAGCGCGGGGTGCT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1022101568 7:27172553-27172575 GGGGTGCTTACTTGGAAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 96
1022101562_1022101568 -5 Left 1022101562 7:27172535-27172557 CCCCCAGGCTAGGAGCGCGGGGT 0: 1
1: 0
2: 0
3: 1
4: 101
Right 1022101568 7:27172553-27172575 GGGGTGCTTACTTGGAAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 96
1022101564_1022101568 -7 Left 1022101564 7:27172537-27172559 CCCAGGCTAGGAGCGCGGGGTGC 0: 1
1: 0
2: 1
3: 23
4: 123
Right 1022101568 7:27172553-27172575 GGGGTGCTTACTTGGAAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 96
1022101558_1022101568 2 Left 1022101558 7:27172528-27172550 CCTGTAGCCCCCAGGCTAGGAGC 0: 1
1: 0
2: 2
3: 18
4: 139
Right 1022101568 7:27172553-27172575 GGGGTGCTTACTTGGAAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 96
1022101554_1022101568 30 Left 1022101554 7:27172500-27172522 CCTCTTGCCATATGGCAGACAAG 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1022101568 7:27172553-27172575 GGGGTGCTTACTTGGAAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 96
1022101563_1022101568 -6 Left 1022101563 7:27172536-27172558 CCCCAGGCTAGGAGCGCGGGGTG 0: 1
1: 0
2: 1
3: 14
4: 110
Right 1022101568 7:27172553-27172575 GGGGTGCTTACTTGGAAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 96
1022101555_1022101568 23 Left 1022101555 7:27172507-27172529 CCATATGGCAGACAAGCATTTCC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1022101568 7:27172553-27172575 GGGGTGCTTACTTGGAAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022101568 Original CRISPR GGGGTGCTTACTTGGAAGAT GGG Intronic
900641897 1:3691542-3691564 GGGCTGCTGGCTTGGAAGAGGGG + Intronic
906126708 1:43431444-43431466 TGGGTGCCTAATTGGAAGAAAGG - Exonic
908444742 1:64190058-64190080 GGGGTGCCTACTTGGAGCAGTGG + Intergenic
913179547 1:116308307-116308329 TGGGTGCTTAGATGGAAAATGGG - Intergenic
914442332 1:147718470-147718492 GGGGTGTCTACTTGGAACAGTGG + Intergenic
917752179 1:178063892-178063914 GGGGTCCTTAGTTAGAAGTTTGG - Intergenic
920435441 1:205943899-205943921 GGGATGCTTGCTTTGAAGATTGG + Intergenic
922008753 1:221559455-221559477 AGGGTGATTACATGGAAGAAAGG - Intergenic
1065246570 10:23764809-23764831 GGGGTGGGAACTTGGAGGATGGG + Intronic
1068683807 10:59848292-59848314 GGGGTCTTTATTTGGAAGTTTGG + Intronic
1068879176 10:62030533-62030555 GGGCTGCTTACATGGATGAGTGG + Intronic
1069098110 10:64284898-64284920 GGTGTGCTGACTTGGAGTATAGG + Intergenic
1071475920 10:86024848-86024870 TGGGTGTTTTCTTGGCAGATAGG - Intronic
1074716962 10:116228646-116228668 GTGTTGCTGACTTTGAAGATGGG + Intronic
1074759122 10:116652798-116652820 GGTGTCATTACTTGTAAGATGGG + Intergenic
1079285127 11:19122311-19122333 GGGGTACTGACTTGTCAGATTGG + Intronic
1079560447 11:21813489-21813511 GGGGTGCCTACTTAGAACAGAGG + Intergenic
1081857195 11:46311314-46311336 GGGATGCTTACCTGGCAGATGGG + Intronic
1082784498 11:57309474-57309496 GCAGTGCTGACCTGGAAGATGGG - Exonic
1085181775 11:74542515-74542537 GGGGTGCCTACTTGGAGCAGTGG + Intronic
1087772867 11:102229345-102229367 GTGGTGCTTATCTGGAAGACAGG + Intronic
1097900579 12:64869268-64869290 TTGGTTCTTATTTGGAAGATAGG + Intronic
1099920436 12:88950919-88950941 GTGGGGCTTTCTTGGGAGATTGG - Intergenic
1104513596 12:129403786-129403808 AGGGTGCTTACTAGGAAGGTAGG + Intronic
1104967216 12:132513737-132513759 GGGGTGGATTCCTGGAAGATGGG + Intronic
1108525717 13:51284434-51284456 GGGGATCTTACTTGGAAAAGAGG - Intergenic
1114916496 14:27273329-27273351 GGCATACTTACATGGAAGATAGG - Intergenic
1119859336 14:77925075-77925097 GGAGCTCCTACTTGGAAGATGGG + Intronic
1120251694 14:82066646-82066668 AGGGTGTTTTCTAGGAAGATTGG - Intergenic
1120731591 14:88008917-88008939 GGGGTCCTCACTTGGAAACTAGG - Intronic
1127268833 15:57382794-57382816 GGGGTCCTCACTTGGAAAATGGG - Intronic
1127689931 15:61385438-61385460 GGAGGGCTTACATGGGAGATGGG + Intergenic
1131568867 15:93511843-93511865 ATGGTGCTTACTTGTCAGATGGG - Intergenic
1135064600 16:19298859-19298881 GGGGTGCTTAGTTGAACTATGGG - Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1145942327 17:28749086-28749108 GGCGTGCTCATCTGGAAGATTGG + Exonic
1151921607 17:77160925-77160947 GGGGTGCTTACTTTGCAGATGGG + Intronic
1155268950 18:24120981-24121003 GGAGTGCTTACCTGGAACATTGG + Intronic
1157118379 18:44884069-44884091 GGGGTGCTAACTAGGCACATGGG - Intronic
1159087977 18:63816198-63816220 GGTGTCCTTACATGTAAGATGGG + Intergenic
1160244449 18:77145734-77145756 GGGCAGCTTTCTTGGAAGGTCGG + Intergenic
1161989936 19:7678835-7678857 GGGGTGCTTCCAAGGAAGGTGGG + Intronic
1162489621 19:10984443-10984465 GAGGGCCTTACTTGGAGGATGGG + Intronic
1162947150 19:14050951-14050973 GGAGTCATTACTTGGAAGCTAGG + Intronic
1164769491 19:30797258-30797280 GTGGGGTTTACTGGGAAGATGGG + Intergenic
1166007445 19:39917145-39917167 GGGGTGCTTACTGGGCAGTGGGG + Intronic
1166122189 19:40692553-40692575 GGGGTGCTTACTCGGGGAATAGG - Intronic
1166449243 19:42884069-42884091 GGGGTACTTTTTTGAAAGATGGG + Intronic
1166863842 19:45824506-45824528 GGGGCCCTTACCTGGAAAATGGG - Intronic
1167412563 19:49353638-49353660 GGGTTGCTTAGCTGGAAGGTAGG - Intronic
1167634177 19:50644365-50644387 TGGGTGCATACATGGATGATTGG + Intronic
928523446 2:32114460-32114482 GGGGTGGTCACTAGGTAGATAGG - Intronic
932124554 2:69131971-69131993 GGGGTGCAGACTTGGTAGAAGGG + Intronic
937992830 2:127673936-127673958 GGGGAGCTAACTGGGAAGAGAGG + Intronic
939753599 2:146080622-146080644 TGGGTACTTACTGGGAAGTTGGG + Intergenic
941783034 2:169469021-169469043 GGGGATCTTAATAGGAAGATAGG + Intergenic
943144585 2:184025797-184025819 GCGGTATTTAGTTGGAAGATAGG - Intergenic
944646899 2:201789157-201789179 GGAGTGCTGACTGGTAAGATTGG + Intergenic
947291619 2:228582251-228582273 AAGCAGCTTACTTGGAAGATGGG - Intergenic
948352081 2:237349111-237349133 GGGGTGATGACTTGGAAGGAAGG - Intronic
1172132521 20:32665058-32665080 GGGGAACTTACTTGGCAGCTTGG - Intergenic
1181504293 22:23341156-23341178 GTGGTGCTGACTTGGAAGGAGGG + Intergenic
1181655402 22:24293767-24293789 GTGGTGCTGACTTGGAAGGAGGG + Intronic
1181709281 22:24671390-24671412 GTGGTGCTGACTTGGAAGGAGGG + Intergenic
1183338145 22:37262790-37262812 GGGCTGCTTCTTTGTAAGATGGG - Intergenic
951905038 3:27697315-27697337 GGTGTGCTTACATGGCAGAAAGG - Intergenic
953769627 3:45770125-45770147 GAGCTGCTGACTTGGGAGATAGG - Intronic
955708329 3:61752201-61752223 GGGGTGCTTAGTTGGGATTTGGG + Intronic
956927687 3:74006550-74006572 GAAGTGCTGATTTGGAAGATTGG + Intergenic
959162552 3:102738970-102738992 GGGGTGCCTACTTAGAACAATGG + Intergenic
959993585 3:112656070-112656092 GGGGTGCATTCTTGGAAGAGAGG + Intergenic
963270244 3:143279371-143279393 GAGGTGTTTACTTAGAAGGTGGG + Intronic
967929165 3:194678162-194678184 GGGCTGCTTGCTTGGAACCTTGG - Intergenic
971010778 4:22431850-22431872 GGGGTCTTTATTTGGAAGTTTGG + Intronic
971555864 4:28012708-28012730 GGGGTGCCTACTTTGAACAGTGG - Intergenic
979856920 4:125644957-125644979 GAGGTGCTTACTTGGAAAAAAGG - Intergenic
984397001 4:179214697-179214719 GGGGTTCTTCCTTTGAGGATAGG + Intergenic
987466475 5:18277843-18277865 GTGTTGCTTACTTAGAAAATGGG - Intergenic
988825785 5:34932981-34933003 GGGGTGCTGTCTTGCAAGCTGGG + Intronic
999104831 5:149062181-149062203 GGGAGGCTTGCTTGGGAGATAGG - Intronic
1009721524 6:67476788-67476810 GGGGTACTTACTTGGCAGTTTGG + Intergenic
1012432629 6:99181768-99181790 GGATTGTTTAATTGGAAGATAGG - Intergenic
1014258194 6:119185431-119185453 GGAGTGCTTTGTTAGAAGATAGG + Intronic
1015660809 6:135571546-135571568 GGGGTACTTTCTTGGGACATAGG + Intergenic
1017719262 6:157233532-157233554 TGGGTGATTTATTGGAAGATTGG + Intergenic
1019316444 7:389120-389142 GGGGTGATTACTTTGAAAACGGG - Intergenic
1019423800 7:963751-963773 ATGGTGCTTACATGGCAGATCGG + Intronic
1021466152 7:20945402-20945424 GAGGTGCTTACTGAGAAGAGGGG - Intergenic
1022078076 7:26993129-26993151 GGGGTGCTCTCTTGGAGGCTAGG - Intronic
1022101568 7:27172553-27172575 GGGGTGCTTACTTGGAAGATGGG + Intronic
1023356813 7:39375482-39375504 GGGGTGCCTCCGTGGAAGGTTGG - Intronic
1031499837 7:122500553-122500575 GGGGTGCCTACTTGCATGAGGGG - Intronic
1036429195 8:8674295-8674317 GGAGTGCTGACTTGGCAGGTTGG - Intergenic
1037796374 8:21998700-21998722 GAGGTGTTTTCTTGGAAGACTGG - Intronic
1041797638 8:61762313-61762335 GGGGTCTTTATTTTGAAGATTGG - Intergenic
1048713519 8:137240974-137240996 AGGGTGGTTACTTGGTAGTTGGG + Intergenic
1051419423 9:16874974-16874996 GGGGTGTTTATTTAGAAGTTTGG + Intergenic
1056440595 9:86617164-86617186 GTGCTGTTTACTAGGAAGATAGG + Intergenic
1061824177 9:133247551-133247573 GTGGTGCTTACTGGACAGATAGG - Intergenic
1186903929 X:14090663-14090685 GGGGTGGTTTTGTGGAAGATAGG + Intergenic
1187833223 X:23404171-23404193 AGGATGCTTCATTGGAAGATGGG - Exonic
1188036538 X:25323900-25323922 GGGGTGATAACTTGGGAGAGTGG + Intergenic
1188504925 X:30872296-30872318 GTGGTGCTTACTTGGGGTATGGG - Intronic
1191062907 X:56318403-56318425 GGGGTGCTGACTTGGCAGTGGGG - Intergenic
1196241160 X:113344700-113344722 GGCGTCCTTACATGTAAGATGGG + Intergenic
1198273629 X:135079998-135080020 GGGGTACTTCCTGGAAAGATTGG + Intergenic