ID: 1022103807

View in Genome Browser
Species Human (GRCh38)
Location 7:27184601-27184623
Sequence GACCTCCGCGGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2495
Summary {0: 2, 1: 0, 2: 37, 3: 258, 4: 2198}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022103807_1022103825 21 Left 1022103807 7:27184601-27184623 CCGCCGCCGCCGCCGCGGAGGTC 0: 2
1: 0
2: 37
3: 258
4: 2198
Right 1022103825 7:27184645-27184667 TTCTCGGCGCTCTTGTCCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 77
1022103807_1022103824 20 Left 1022103807 7:27184601-27184623 CCGCCGCCGCCGCCGCGGAGGTC 0: 2
1: 0
2: 37
3: 258
4: 2198
Right 1022103824 7:27184644-27184666 CTTCTCGGCGCTCTTGTCCCCGG 0: 1
1: 0
2: 0
3: 13
4: 105
1022103807_1022103818 5 Left 1022103807 7:27184601-27184623 CCGCCGCCGCCGCCGCGGAGGTC 0: 2
1: 0
2: 37
3: 258
4: 2198
Right 1022103818 7:27184629-27184651 GGCCGCCGGGGGCCCCTTCTCGG 0: 1
1: 0
2: 0
3: 22
4: 187
1022103807_1022103814 -8 Left 1022103807 7:27184601-27184623 CCGCCGCCGCCGCCGCGGAGGTC 0: 2
1: 0
2: 37
3: 258
4: 2198
Right 1022103814 7:27184616-27184638 CGGAGGTCGCCGTGGCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 104
1022103807_1022103816 -6 Left 1022103807 7:27184601-27184623 CCGCCGCCGCCGCCGCGGAGGTC 0: 2
1: 0
2: 37
3: 258
4: 2198
Right 1022103816 7:27184618-27184640 GAGGTCGCCGTGGCCGCCGGGGG 0: 1
1: 0
2: 0
3: 11
4: 120
1022103807_1022103826 22 Left 1022103807 7:27184601-27184623 CCGCCGCCGCCGCCGCGGAGGTC 0: 2
1: 0
2: 37
3: 258
4: 2198
Right 1022103826 7:27184646-27184668 TCTCGGCGCTCTTGTCCCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1022103807_1022103815 -7 Left 1022103807 7:27184601-27184623 CCGCCGCCGCCGCCGCGGAGGTC 0: 2
1: 0
2: 37
3: 258
4: 2198
Right 1022103815 7:27184617-27184639 GGAGGTCGCCGTGGCCGCCGGGG 0: 1
1: 0
2: 3
3: 21
4: 194
1022103807_1022103827 29 Left 1022103807 7:27184601-27184623 CCGCCGCCGCCGCCGCGGAGGTC 0: 2
1: 0
2: 37
3: 258
4: 2198
Right 1022103827 7:27184653-27184675 GCTCTTGTCCCCGGGGTAGTCGG 0: 1
1: 0
2: 0
3: 4
4: 82
1022103807_1022103813 -9 Left 1022103807 7:27184601-27184623 CCGCCGCCGCCGCCGCGGAGGTC 0: 2
1: 0
2: 37
3: 258
4: 2198
Right 1022103813 7:27184615-27184637 GCGGAGGTCGCCGTGGCCGCCGG 0: 1
1: 0
2: 0
3: 19
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022103807 Original CRISPR GACCTCCGCGGCGGCGGCGG CGG (reversed) Exonic