ID: 1022104392

View in Genome Browser
Species Human (GRCh38)
Location 7:27188045-27188067
Sequence CATGGGAGGCAGTGGTTATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022104392_1022104405 14 Left 1022104392 7:27188045-27188067 CCGCATAACCACTGCCTCCCATG No data
Right 1022104405 7:27188082-27188104 CGAACCGAGAGGGTGCTGGCAGG No data
1022104392_1022104409 28 Left 1022104392 7:27188045-27188067 CCGCATAACCACTGCCTCCCATG No data
Right 1022104409 7:27188096-27188118 GCTGGCAGGGCTGGATCCCACGG No data
1022104392_1022104406 15 Left 1022104392 7:27188045-27188067 CCGCATAACCACTGCCTCCCATG No data
Right 1022104406 7:27188083-27188105 GAACCGAGAGGGTGCTGGCAGGG No data
1022104392_1022104400 3 Left 1022104392 7:27188045-27188067 CCGCATAACCACTGCCTCCCATG No data
Right 1022104400 7:27188071-27188093 TCCTCGAGGGCCGAACCGAGAGG No data
1022104392_1022104402 4 Left 1022104392 7:27188045-27188067 CCGCATAACCACTGCCTCCCATG No data
Right 1022104402 7:27188072-27188094 CCTCGAGGGCCGAACCGAGAGGG No data
1022104392_1022104403 10 Left 1022104392 7:27188045-27188067 CCGCATAACCACTGCCTCCCATG No data
Right 1022104403 7:27188078-27188100 GGGCCGAACCGAGAGGGTGCTGG No data
1022104392_1022104410 29 Left 1022104392 7:27188045-27188067 CCGCATAACCACTGCCTCCCATG No data
Right 1022104410 7:27188097-27188119 CTGGCAGGGCTGGATCCCACGGG No data
1022104392_1022104408 19 Left 1022104392 7:27188045-27188067 CCGCATAACCACTGCCTCCCATG No data
Right 1022104408 7:27188087-27188109 CGAGAGGGTGCTGGCAGGGCTGG No data
1022104392_1022104395 -10 Left 1022104392 7:27188045-27188067 CCGCATAACCACTGCCTCCCATG No data
Right 1022104395 7:27188058-27188080 GCCTCCCATGTCCTCCTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022104392 Original CRISPR CATGGGAGGCAGTGGTTATG CGG (reversed) Intergenic
No off target data available for this crispr