ID: 1022104396

View in Genome Browser
Species Human (GRCh38)
Location 7:27188059-27188081
Sequence GCCCTCGAGGAGGACATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022104396_1022104409 14 Left 1022104396 7:27188059-27188081 CCTCCCATGTCCTCCTCGAGGGC No data
Right 1022104409 7:27188096-27188118 GCTGGCAGGGCTGGATCCCACGG No data
1022104396_1022104403 -4 Left 1022104396 7:27188059-27188081 CCTCCCATGTCCTCCTCGAGGGC No data
Right 1022104403 7:27188078-27188100 GGGCCGAACCGAGAGGGTGCTGG No data
1022104396_1022104405 0 Left 1022104396 7:27188059-27188081 CCTCCCATGTCCTCCTCGAGGGC No data
Right 1022104405 7:27188082-27188104 CGAACCGAGAGGGTGCTGGCAGG No data
1022104396_1022104410 15 Left 1022104396 7:27188059-27188081 CCTCCCATGTCCTCCTCGAGGGC No data
Right 1022104410 7:27188097-27188119 CTGGCAGGGCTGGATCCCACGGG No data
1022104396_1022104411 25 Left 1022104396 7:27188059-27188081 CCTCCCATGTCCTCCTCGAGGGC No data
Right 1022104411 7:27188107-27188129 TGGATCCCACGGGTGTCCGCAGG No data
1022104396_1022104408 5 Left 1022104396 7:27188059-27188081 CCTCCCATGTCCTCCTCGAGGGC No data
Right 1022104408 7:27188087-27188109 CGAGAGGGTGCTGGCAGGGCTGG No data
1022104396_1022104406 1 Left 1022104396 7:27188059-27188081 CCTCCCATGTCCTCCTCGAGGGC No data
Right 1022104406 7:27188083-27188105 GAACCGAGAGGGTGCTGGCAGGG No data
1022104396_1022104402 -10 Left 1022104396 7:27188059-27188081 CCTCCCATGTCCTCCTCGAGGGC No data
Right 1022104402 7:27188072-27188094 CCTCGAGGGCCGAACCGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022104396 Original CRISPR GCCCTCGAGGAGGACATGGG AGG (reversed) Intergenic
No off target data available for this crispr