ID: 1022104402

View in Genome Browser
Species Human (GRCh38)
Location 7:27188072-27188094
Sequence CCTCGAGGGCCGAACCGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022104396_1022104402 -10 Left 1022104396 7:27188059-27188081 CCTCCCATGTCCTCCTCGAGGGC No data
Right 1022104402 7:27188072-27188094 CCTCGAGGGCCGAACCGAGAGGG No data
1022104393_1022104402 -4 Left 1022104393 7:27188053-27188075 CCACTGCCTCCCATGTCCTCCTC No data
Right 1022104402 7:27188072-27188094 CCTCGAGGGCCGAACCGAGAGGG No data
1022104392_1022104402 4 Left 1022104392 7:27188045-27188067 CCGCATAACCACTGCCTCCCATG No data
Right 1022104402 7:27188072-27188094 CCTCGAGGGCCGAACCGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022104402 Original CRISPR CCTCGAGGGCCGAACCGAGA GGG Intergenic
No off target data available for this crispr