ID: 1022107935

View in Genome Browser
Species Human (GRCh38)
Location 7:27210199-27210221
Sequence TCCAGGGATTTGCCCGCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022107927_1022107935 5 Left 1022107927 7:27210171-27210193 CCCTCCAGGAGAACCTACATATG No data
Right 1022107935 7:27210199-27210221 TCCAGGGATTTGCCCGCATTAGG No data
1022107924_1022107935 21 Left 1022107924 7:27210155-27210177 CCAGAGCCACTCTGCACCCTCCA No data
Right 1022107935 7:27210199-27210221 TCCAGGGATTTGCCCGCATTAGG No data
1022107922_1022107935 23 Left 1022107922 7:27210153-27210175 CCCCAGAGCCACTCTGCACCCTC No data
Right 1022107935 7:27210199-27210221 TCCAGGGATTTGCCCGCATTAGG No data
1022107923_1022107935 22 Left 1022107923 7:27210154-27210176 CCCAGAGCCACTCTGCACCCTCC No data
Right 1022107935 7:27210199-27210221 TCCAGGGATTTGCCCGCATTAGG No data
1022107934_1022107935 -8 Left 1022107934 7:27210184-27210206 CCTACATATGGGCGCTCCAGGGA No data
Right 1022107935 7:27210199-27210221 TCCAGGGATTTGCCCGCATTAGG No data
1022107928_1022107935 4 Left 1022107928 7:27210172-27210194 CCTCCAGGAGAACCTACATATGG No data
Right 1022107935 7:27210199-27210221 TCCAGGGATTTGCCCGCATTAGG No data
1022107931_1022107935 1 Left 1022107931 7:27210175-27210197 CCAGGAGAACCTACATATGGGCG No data
Right 1022107935 7:27210199-27210221 TCCAGGGATTTGCCCGCATTAGG No data
1022107926_1022107935 15 Left 1022107926 7:27210161-27210183 CCACTCTGCACCCTCCAGGAGAA No data
Right 1022107935 7:27210199-27210221 TCCAGGGATTTGCCCGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022107935 Original CRISPR TCCAGGGATTTGCCCGCATT AGG Intergenic
No off target data available for this crispr