ID: 1022108338

View in Genome Browser
Species Human (GRCh38)
Location 7:27212790-27212812
Sequence CACTTCTGCCCCTCCGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022108328_1022108338 1 Left 1022108328 7:27212766-27212788 CCGCACCCTTCCGCTGAAGTCCC No data
Right 1022108338 7:27212790-27212812 CACTTCTGCCCCTCCGAGGTGGG No data
1022108331_1022108338 -9 Left 1022108331 7:27212776-27212798 CCGCTGAAGTCCCCCACTTCTGC No data
Right 1022108338 7:27212790-27212812 CACTTCTGCCCCTCCGAGGTGGG No data
1022108330_1022108338 -5 Left 1022108330 7:27212772-27212794 CCTTCCGCTGAAGTCCCCCACTT No data
Right 1022108338 7:27212790-27212812 CACTTCTGCCCCTCCGAGGTGGG No data
1022108325_1022108338 29 Left 1022108325 7:27212738-27212760 CCGAGGCTCAGGAGACCTCTTCA No data
Right 1022108338 7:27212790-27212812 CACTTCTGCCCCTCCGAGGTGGG No data
1022108329_1022108338 -4 Left 1022108329 7:27212771-27212793 CCCTTCCGCTGAAGTCCCCCACT No data
Right 1022108338 7:27212790-27212812 CACTTCTGCCCCTCCGAGGTGGG No data
1022108327_1022108338 14 Left 1022108327 7:27212753-27212775 CCTCTTCAGGCGACCGCACCCTT No data
Right 1022108338 7:27212790-27212812 CACTTCTGCCCCTCCGAGGTGGG No data
1022108324_1022108338 30 Left 1022108324 7:27212737-27212759 CCCGAGGCTCAGGAGACCTCTTC No data
Right 1022108338 7:27212790-27212812 CACTTCTGCCCCTCCGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022108338 Original CRISPR CACTTCTGCCCCTCCGAGGT GGG Intergenic
No off target data available for this crispr