ID: 1022108730

View in Genome Browser
Species Human (GRCh38)
Location 7:27214682-27214704
Sequence CTTTGGGGCTGCAGCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022108730_1022108738 22 Left 1022108730 7:27214682-27214704 CCTGGGTGGCTGCAGCCCCAAAG No data
Right 1022108738 7:27214727-27214749 TCTGCATAACAAAGTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022108730 Original CRISPR CTTTGGGGCTGCAGCCACCC AGG (reversed) Intergenic
No off target data available for this crispr